Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4452
Length(NT) : 777
Best Gene Model Blast : Link to GSTUMT00000257001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: acetyltransferase, GNAT family, putative
Accession: ref|XP_001270994.1| Score: 614 E_value: 5e-62
KEGG Definition: acetyltransferase, GNAT family, putative [EC:2.3.1.128]; K00676 ribosomal-protein-alanine N-acetyltransferase
Accession: afm:AFUA_3G09940 Score: 596 E_value: 3e-60
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3139 Score: 474 E_value: 2e-48
PFAM Definition: Acetyltransf_1, Acetyltransferase (GNAT) family. This family contains proteins with N-acetyltransferase functions such as Elp3-related proteins..
Pfam Number: pfam00583 Score: 181 E_value: 2e-14
Swissprot: Q03503|MAK3_YEAST
Gene Ontology:
GO:0031417 = Cellular component: NatC complex
GO:0004596 = Molecular function: peptide alpha-N-acetyltransferase activity
GO:0005515 = Molecular function: protein binding
GO:0006474 = Biological process: N-terminal protein amino acid acetylation
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig4452
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTTTCACCAAAGAAACGCC
GCAACCAGCCCACCAAGTTTTCGATAATCCTGGCAGAGCCTCGGCCCTTC
CTCCCCCCCAAAAAACCTCTACAATGCCAGAAATAACTTACACCCCCTAC
GACGCAACCCAAGAACCGAGACAACTTGAGTCCATCCGCACGCTGATATC
CACCGACCTCTCCGAGCCATACAGCATCTACGTCTACCGTTACTTTCTCT
ATCAATGGGGAGAGCTATGTTATATGGCAATGGACGAGGGATCTATGATC
GGCGTCGTAGTCTGCAAACTTGAGACCCATCGCGGCGGGCCGATGCGTGG
GTATATTGCCATGCTAGCTGTTAAAGAACGCTATCGTGGTAAAGGGATCG
CCACGAATTTGGTCAAAATGGCGATTAAAGCTATGATTGAGAGGGATGCT
GATGAGGTAGCGTTGGAGACAGAAATTACCAATACTGCTGCCATGAGGCT
TTACGAAGGGTTGGGGTTTTTGCGGAGTAAGCGATTGCATAGGTATTATT
TGAACGGGAATTCGGCGTTTAGGTTGCTGCTACCGTTGAAGAGCCAGCAG
GAGCTGGGGCAGCGGTACCATGAGCATGAGCATGAGGAGTGCTGTGAACA
TGAACATGGGAAGCATGAACATGAGCACGAGCACGAGAGCGTGCACAGCA
AAGACGACTGACACATGACGTTACGTATGACAGGTGCGGTAGTGCGAGAG
AGAGATGGAAATTTAACCATTACGAGG

Sequences in the Contig:

SY0AAA13YO05FM1 SY0AAA54YE17FM1 SY0AAA62YL16FM1
SY0AAC32YN09FM1 SY0AAC33YB09FM1 SY0AAD25YB09FM1