Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4451
Length(NT) : 1426
Best Gene Model Blast : Link to GSTUMT00012080001 E-value : 0.0
Numbers of ESTs : 44

Blast Results:

Nr Definition: O-methyltransferase, putative
Accession: ref|XP_001276267.1| Score: 595 E_value: 2e-59
KEGG Definition: O-methyltransferase, putative [EC:2.1.1.-]; K00599
Accession: afm:AFUA_5G02640 Score: 581 E_value: 4e-58
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3178 Score: 199 E_value: 4e-16
PFAM Definition: Methyltransf_2, O-methyltransferase. This family includes a range of O-methyltransferases. These enzymes utilise S-adenosyl methionine..
Pfam Number: pfam00891 Score: 341 E_value: 1e-32
Swissprot: P55790|OMTA_ASPFL
Gene Ontology:
GO:0047146 = Molecular function: sterigmatocystin 7-O-methyltransferase activity

Sequence:
>Contig4451
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCAGAATTTCTAATCTTATCA
GTTCAATACCACTAAATTTTCCTGGTACCGATTACGACCTTAACAATGGC
AACAAGAACCGAAGACCTCACGGAACTCTCTAACATCATCTCCACAAGCA
TAAAGAACTATCTCTCCCACGTCCCCACTCCACCCACCCTCCGACCAGTA
CCTCCAATTCCTGTGACCGACGAGGTGGCTGTTGAAGTAGCAGACGAACT
CTTAGTGGCATGTCGGAGGGTCATTTCTCTGGTTGAGGGCCCCATAAGGA
CCGCGCTCATGATGTCAAGTGGGTTTCAAGACTCTATTGCCATGAAACTG
GCGTACGACATGAAGCTGGCGCAGAACGTGCCACCCGATGGATCGCCTAT
CGCTCTGGCGGAGTTGGCTTCAAAGACGGGGGTGCCTGAGGAGACTATTG
TGAGAGTGATGCGGCAATTGACGTCGAAGAATGTGTTTGTCGAGACGGCG
CCGGGGTATATTGCGCACACTGGTGGCTCTGCGGCCATCGGGCTTCCCGG
GGTTGGCTCCATGGTTGCGCATCTCGTCGACGAAGGACTCACCTCGGCGC
CTCACGTCTCCGACATTCTGCGTGAAAACGAATTCGTGGTTCCCGAAGAT
AGTAGGAAATCCGCTTTCAGTCGGGCCTTCAATACGAACAAGAGCTACTT
CGAATACATCTGCACCGACAACAAACCTCTGGGCACACGTTTCGGCCAAG
CTATGAAAGCCATGAACGTTGTTGATGGCCTACCCAACCTCGTGGCGCTC
TACGAACCCCTCCAGTCCGCCCCCAAAGGCACAATATTAGTAGACATCGG
CGGTGGCCTCGGACACGCCGCTATCGCCGCAGCACAGAAATTTCCAAACT
TGAAATGCATTGTGCAGGATATAGGAATGGTGGTCAGTGAAGGGCGCGAT
GAACTTCCCGAGGAGCTTAAAGACCGTGTGGAGTTTCATGAAAATGATTT
CTTCGAGGGGCAGCCGATTGGTGGGCCTGGGGTTTATTACTATCTCAAGT
ATATCTTGCATGATCATCCTGACCCTGCTAGTAAAAAGATCCTGTCGCAC
ATTGTGAGGGCTATGGACTCCAGCTCTAGACTCCTCATCGATGAGCATAT
CGTGGAGGAGCGTATGGGTCCTGATAGTCACAAGTTGATTCCATTTTTGG
ACTTTCATATGCTTCTTTTGTTTAATAGTAAGGAGAGGACTGAAGCTCAA
TGGGCGGCGTTGCTAAAGGGCGTGGATGAAAGATTGGTTGTGGAGAGAGT
GTGGAGGGCCAAGGGGACGGGCAACGGGATTATTGAGGTTAGATTGGCTT
GATGGGGCCCATTGGGCGGTGTTATGATAGTAAGACCGTGGATATATGGA
ACGAAGAGTGGAATGGGTTTATTGTC

Sequences in the Contig:

SY0AAA41YI17FM1 SY0AAB16YP20FM1 SY0AAB8YA19FM1
SY0AAC16YB10FM1 SY0AAC1YD18FM1 SY0AAC30YL10FM1
SY0AAC31YF19FM1 SY0AAC31YF19RM1 SY0AAC33YA23FM1
SY0AAC34YC03FM1 SY0AAC42YD14FM1 SY0AAC52YB11FM1
SY0AAC52YI11FM1 SY0AAC52YM23FM1 SY0AAC54YI11FM1
SY0AAC57YL02FM1 SY0AAC58YD22FM1 SY0AAC59YJ06FM1
SY0AAC5YN07FM1 SY0AAC61YB10FM1 SY0AAC62YK24FM1
SY0AAC6YL21FM1 SY0AAC7YA06FM1 SY0AAC7YE06FM1
SY0AAD16YO18FM1 SY0AAD19YI22FM1 SY0AAD28YE03FM1
SY0AAD30YP18FM1 SY0AAD31YL13FM1 SY0AAD32YM03FM1
SY0AAD33YD24FM1 SY0AAD34YC02FM1 SY0AAD35YK11FM1
SY0AAD38YA09FM1 SY0AAD48YD21FM1 SY0AAD48YH12FM1
SY0AAD52YM19FM1 SY0AAD57YA24FM1 SY0AAD59YM02FM1
SY0AAD5YH02FM1 SY0AAD62YO23FM1 SY0AAD62YP19FM1
SY0AAD6YL17FM1 SY0AAD7YI24FM1