Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4450
Length(NT) : 807
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: orf261
Accession: ref|YP_203356.1| Score: 145 E_value: 1e-07
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4450
AAGAAATGCGGGCCATCCTTTATTAAATTATCACTTATCTTATTTATAAT
TAAGTATTAATAAAGGGCCATAGAAATTATTATTCTACAGCATAGATTTA
CTAGCATATAGTATAGAAATGACCCTATTTTCACAAATAGGACGGCATTA
TTTAATATTCTAAATAAGACGGTGGTTTAATCTTATTTAAAATTAGTTTA
TTAATTTTGTTTCATTTCCCTCCTTAATCCCTCATTAAATTTTACATTTA
ACTACACTAATATAAAGACTTATTACATAAAAACTTGTTACAATTTAGTA
TAAATAAGACTTTAACCCTATTAACATTTTTAACTAGGTATTTTATTGAA
CTTTAGAAAGTCAACTTATTAAAAACCTCGCGGATCCGACCCAGATTATT
AAATCCGTTCTGAAGAATAAAAATAATATTTATTGTTTATAAGTCGCCCT
GTATCTAAATTTTTCACAATAGTTGGTCGACTTACCTCTATTCTATAATC
AGCTGCAGCAGCATTAGCTGAAGGAAAAAAATCAATAAATTGCATGTTAG
CATCATACACAAATATAGGAGTACCTTTAGCTTCAGACATTTTTAATTTG
GTTTCTGTAGTATGAATTTTTCCAAAGAAAGGATTTTTTACACCATAAAA
TTTATGACCAAACATTGGGTTCCTAGAGCCTTTATTATGAAGAGATCTTT
CTTGATTCATTAATGTTTTATAAGCATCTAATGTTAAAGTTGGAAAATCG
TCAACAGAAAAAGGTACACTTGTAATAAATAAATTTTCTCTATAATATAA
GTCTTTA

Sequences in the Contig:

SY0AAC27YL24FM1 SY0AAC33YA19FM1