Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig445
Length(NT) : 655
Best Gene Model Blast : Link to GSTUMT00003767001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: putative glycosyl hydrolase
Accession: gb|ABA54914.1| Score: 808 E_value: 1e-84
KEGG Definition: predicted protein
Accession: aor:AO090005001389 Score: 783 E_value: 4e-82
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P40566|YIS7_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm

Sequence:
>Contig445
TTGGCGGCAACGGATACGATTCTTAAAAATGATTATTTTGGCAAGATGCC
GAATGGTGAACTGCTTAGTCCTGAGAAGTTCACTGAAACATACTTTTTGG
ATCATTACCGGAAGTATGCCGCGGCCATAAGATCAATACATAAAAGTACC
ATAATGTTTTGCCAGCCACCCGTTTTCGAGATACCACCTGTCATCAAGGA
TACGCCCGATGCCCATGGTAGGATGGTTTATGCACCACATTTTTATGATG
GGATCACACTCATGACGAAAAAATGGAACCGACTTTGGAACATTGATGTT
CTCGGTGTTCTCAGAGGACGATATCTAGCGCCAGGCTTTGCGCTGAAGAT
CGGGGAGACTGCTATCCGGAATTGCCTTCGAGATCAATTGAAGGCTATGA
AACAGGAGGGTGTAGACAACATGGGGTTGACCCCGTGCGTATTCACCGAG
ATAGGAGTTCCTTATGATATGGACGATAAATATGCGTACAAAACTGGGGA
CTATATCTCCCAAATCAGAGCAATGGACGCAAATCACTATGCTCTAGAAG
GAGCGCAGGTTGGGTTTACCTTGTGGACGTATTGTGTAGAGAATAACCAT
GAATGGGGTGACCAATGGAATGGCGAAGACCTAAGTATCTTCTCGCTGGA
TGATC

Sequences in the Contig:

SY0AAA24YD06FM1 SY0AAA24YD06FM2