Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4449
Length(NT) : 2293
Best Gene Model Blast : Link to GSTUMT00008425001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: DNA topoisomerase I
Accession: ref|XP_001211728.1| Score: 1996 E_value: 0.0
KEGG Definition: DNA topoisomerase I [EC:5.99.1.2]; K03163 DNA topoisomerase I
Accession: aor:AO090005000750 Score: 1988 E_value: 0.0
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0981 Score: 1830 E_value: 0.0
PFAM Definition: Topoisom_I, Eukaryotic DNA topoisomerase I, catalytic core. Topoisomerase I promotes the relaxation of DNA superhelical tension by introducing a transient single-stranded break in duplex DNA and are vital for the processes of replication, transcription, and recombination..
Pfam Number: pfam01028 Score: 895 E_value: 1e-96
Swissprot: Q00313|TOP1_CANAL

Sequence:
>Contig4449
TTGGGATGAAATATGGCGGGGTCGAAGTGACATTGCCGCTTGAGGCAGAG
GAGGTTGCCGGATTTTTTGGCGCTATGCTCGACACGCAACATGCTTCGAA
CCCGACCTTTGCTGAAAATTTCTTCAAAGATTTTCAAGCCATATTAAAAC
AGTCCGGAGGTGCTAAGGGTCCTGATGGCAAGAGCGTCAACATCCTGTCT
TTTCAAAAATGCGACTTCAAACCAATGTACGACTACTTTGAAGAGAAGAA
AGCAGAGAAAAAGGCTCTGGGTCTGGCTGGGCGTAAGGCGTTAAAGGCGG
AGAAGGACAAGGCAGAAGAGAAATATCTCTACTGTTATCTCGACGGCCGT
AAAGAGAAAGTTGGCAACTTCCGTGTGGAGCCCCCCGGACTGTTTCGTGG
CCGCGGAGAGCATCCCAAAACCGGGATGGTCAAGGCGCGGGTTCAACCTG
AGCAGGTCACGATCAATATCGGGAAGGAGGCAACTGTGCCGGCTCCACCA
CCCGGGCACAGCTGGGCAGATGTCATCCACGACAACACAGTTACTTGGCT
TGCAACTTGGAAGGAGAATATCAATGGCAATATCAAGTATGTAATGTTGG
CGGCTACGAGTAGCCTAAAGGGGATGAGTGATTTCAAAAAGTTTGAGAAA
GCCCGCGAATTGAAGAATCATATAGATCGTATCCGCGAGGATTATACACG
GGACCTTAAATCTGAGCTTATGGCTGACCGCCAAAGAGCCACGGCGATGT
ACCTCATCGACAAGCTGGCACTCAGAGCAGGAAATGAGAAGAGCGATGAT
GAAGCAGACACGGTCGGTTGTTGTTCGCTTCGTTATGAGCACATTACATT
GGAGCCTCCGAATGTTGTTGTATTCGATTTCTTGGGTAAGGACTCGATCA
GGTTTTACCAGAAAACCCCTGTTATTCATCAGGTGTTTAAGAACTTGAAG
ATTTTCAAGAAGGCACCTAAGACCAAGGGTGACATGATCTTTGATCGTCT
TGATACGACCCAATTAAATAAGCATCTTCAGAACTATATGCAAGGACTTT
CAGCCAAAGTATTCCGTACCTATAACGCATCTTGGACCATGCAGGAACAA
TTGGACGAGATTCCAAATGAGGGCGCTGTACATGAGAAATATGCCGCATA
TAACCTCGCCAATAAGAAGGTCGCTATCCTCTGTAACCATCAACGGACCG
TGAGCACTACTCACGAGACCATGATGCAGAAACAGGAGGAAAAGATCAAA
GGACTCAGGTACCAGAAGCTTCGTCTAAAGAGGATGATTCTTTCTCTCGA
ACCAACCCGCAAGAAGAAGAATCCCGCTTTTTTCAAACCTGATCCTGAAA
TTGATGACGAGGAATGGATCAAGGAGCACCAGTTTTCCCTCGTTGAACAG
GAGAAAGAGCGTATTACCAAGAAGTTTGAAAAGGATAATGAGAAGCTTCA
GGAGAACGGAGAAAAAGTGCTTAAAGACAAAGAGCTCAAGGAACGTTTAC
AGGTCATTAAAGATATGGAAGCAGAGTTCAAGACAGAGAACAAAACCGGC
AAAATCGAACCTAAGCGCGGAGCGACCGTCGAGAAGCTCGAGGCCCAGAT
CCAAAAAATGGAGGAACGGATCAAGAAGCAGGAAACCGAGGCCCAGGTTC
GAGAGGACAACAAGACAGTCGCCTTGGGCACCAGTAAGATCAACTACATT
GACCCCCGTCTCACTGTCATGTTCTGCAAGAAATACGGTGTCCCCATAGA
GAAAATCTTTGCGAAGACCCTGCGGGATAAATTCAAGTGGGCGATTGAGT
CTGCCGATGGGGATTGGAAGTTTTAAGTAACCTCCAGAATCCATCCCCTT
CACCCCTAAGGAGCAAAATCCACCCAAAATAAACTATTGCAACGTTCTTG
GATACTACCATCTGGCCTTTGCCTTGCTCTGCATGCTGGTATAGCGGGTA
ACGAGGTGGCATCATCATAACAATCACCCTGTTTCCTGTTCTAGACAATG
GAGCAGAGAGAAGCAAAAAAAAAAAAAGGAAATAAAGAGAATCCAACCCT
TTGCTTAAGGCTTATGTAAATTATTCCAGATTCTGTTATTACTTTCATTC
CCCTTCTCTGACCCCCTTCCTTTTCTCCTCCCCCACCGTATTACGACTAC
TCACTTCTGTTGATCACCCCCTTTCCTCGCTGATTAGCGATTTCCCTTTC
CTTTTTTTTCTTTCTAAAATGCCTATCACGCTTGTACCAAAACCTCTTTT
TTATTCATTTCGTGGACTCTGTTTTTCCTCTCCCCCCCCCCTC

Sequences in the Contig:

SY0AAA4YL19FM1 SY0AAA56YB17FM1 SY0AAC33YA14FM1
SY0AAC33YL10FM1 SY0AAC43YK20FM1 SY0AAC6YP04FM1
SY0AAC8YN14FM1 SY0AAD39YA04FM1 SY0AAD4YE04FM1