Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4448
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00004272001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SS1G_05777
Accession: ref|XP_001592855.1| Score: 453 E_value: 2e-43
KEGG Definition: hypothetical protein
Accession: fgr:FG09305.1 Score: 416 E_value: 2e-39
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG3962 Score: 165 E_value: 1e-12
PFAM Definition: Fascin, Fascin domain. This family consists of several eukaryotic fascin or singed proteins. The fascins are a structurally unique and evolutionarily conserved group of actin cross-linking proteins. Fascins function in the organisation of two major forms of actin-based structures: dynamic, cortical cell protrusions and cytoplasmic microfilament bundles. The cortical structures, which include filopodia, spikes, lamellipodial ribs, oocyte microvilli and the dendrites of dendritic cells, have roles in cell-matrix adhesion, cell interactions and cell migration, whereas the cytoplasmic actin bundles appear to participate in cell architecture. Dictyostelium hisactophilin, another actin-binding protein, is a submembranous pH sensor that signals slight changes of the H+ concentration to actin by inducing actin polymerisation and binding to microfilaments only at pH values below seven. Members of this family are histidine rich, typically contain the repeated motif of HHXH..
Pfam Number: pfam06268 Score: 117 E_value: 4e-07
Swissprot: Q9P7X3|YH6C_SCHPO
Gene Ontology:
GO:0005730 = Cellular component: nucleolus

Sequence:
>Contig4448
TTGGCACTAACCAAACAACACAATGGTAAAAGCACTCCGATTCAAAGGCG
ACAAGAAAGTCAAGAAGAGGAAGAGGACAGAAGTCGATAATGGCAACACT
GAAGAAAGTTCTTCGTCAAAAGTTGCCAAACAACAGGAGAGCGAGGAGCC
AGAGGGATGGGTTGATTCCGAGAGCTTAGAGGATATTAACGGACCGATAA
TTCTTACCTTTTCCGCAGCAAGACCGATATGTATCGCCTGCGACGCCGTA
GGGAAAGTCTTTGCATCCCCGATTGATTCAACCGAAGGTGAAGATCTATC
TACGGCGGAGCCCACAGATGTTAAGCAAGTCTGGGTTGCAACCAAGATAC
ACGGTACCGAGAAATACTCTTTCAAATCTCATCACGGAAGGTATCTTTCG
TGTGACAAATTTGGGGGCCTAAGCGCTACACGGGAAGCCATCTCGCCGGA
GGAAGAATTCTTGCCTGTTCTAAATGAATTGGGAAGTGGAAGGTGGGCGC
TGCAGACCGTCAGGGATAAATTTCTCAGTGTAGATGAGGTGGGCGCTGGT
GGGGCTACGGAAATTCGTGGTGATGCGGAAGCCGTCGGGTTTAAGGAGAC
GTTTGTTGTTCGGTTACAGGCGAGAAATAAGAAGAGGAAGAAGTCGGGGA
CAGAAGGGAAGGGCAAGGATAAGATTACAC

Sequences in the Contig:

SY0AAC33YA09FM1 SY0AAD62YI20FM1 SY0AAD62YK02FM1