Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4447
Length(NT) : 599
Best Gene Model Blast : Link to GSTUMT00003858001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: glutamine-dependent NAD(+) synthetase
Accession: ref|XP_001266199.1| Score: 503 E_value: 2e-49
KEGG Definition: hypothetical protein [EC:6.3.5.1]; K01950 NAD+ synthase (glutamine-hydrolysing)
Accession: ani:AN8203.2 Score: 500 E_value: 2e-49
KOG Definition:
Classification: [Coenzyme transport and metabolism, General function prediction only].
Kog Number: KOG2303 Score: 511 E_value: 8e-53
PFAM Definition: No Hit Found
Swissprot: P38795|NADE_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0016811 = Molecular function: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides
GO:0042802 = Molecular function: identical protein binding
GO:0003952 = Molecular function: NAD+ synthase (glutamine-hydrolyzing) activity
GO:0009435 = Biological process: NAD biosynthetic process

Sequence:
>Contig4447
GGAGGGGTAAATAAAAACTTTAAAGATCCCACTTGACAGTTTATCGTTGG
AATTGTACTTCGCACAGCGAACAAGATCAATGGCTACGATATCCCGAGCG
GTATCTGGTGAAGAAACCAGGCAACTATCCGCAACACGTGGTAGCTTCCG
CCCTCAGTATATCACCCAATATCGGACTCCTGCTCCCACGTCACTCTAAT
CCATCTTCTCTCTAGCATTGATAGCAGCAACCGTCTCCTCAATCTTCCTA
AACGGCCATGAGAATGGCGGATATAAAAACGGCCTAAGGTCAAACCGGTT
ATCGTCAGGGCTATACTGCTCGGCGTGGTATGCAGGCGTCAAGACTGTCA
TCTTATGTCTATTAATTGCGTAATAGTAAAAGAAATTCCGGGTCTTAGTA
GCGATAGCTCGAGGGCTCATCCTATCTCCCCACTCGTGCAGGAGCCGATT
GAATGCACTCCAGGGTCCAAGTTTGTGGTTCTTGCGCAATTGGCCAAAGG
TGGAGAGTTCATCGTATGTAAAGCCCATGTCTGCCTCGTCGGATTGCACG
TACGTGCTAGTTATGGGTTCGAGTTCGGCTGTTGGGATCGCGGTGCCAA

Sequences in the Contig:

SY0AAB56YB17FM1 SY0AAC27YG03RM1 SY0AAC32YP17RM1