Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4442
Length(NT) : 798
Best Gene Model Blast : Link to GSTUMT00004402001 E-value : 1e-175
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein AN5931.2
Accession: ref|XP_663535.1| Score: 229 E_value: 2e-17
KEGG Definition: hypothetical protein [EC:3.6.1.-]; K01529
Accession: ani:AN5931.2 Score: 229 E_value: 1e-17
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0331 Score: 305 E_value: 9e-29
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 127 E_value: 4e-08
Swissprot: Q5B0J9|DBP2_EMENI

Sequence:
>Contig4442
TTGGGTGGCCAGTCGTGGCATTGGTATGATATTTGCACGCCTTTTCTTTA
ACCCCGTTTCCCCTTCGTGTGTTAGCGTACAGATGCTCTTCTCTCGACAC
TCCGCCGGACTTGCTGCCATATCTTGCTTCTATTCCGGTGTCTGTTGGTT
TTCTCCCATGAGAACTTTATCTCGGGGTGCAGCGATCCAAGTCTCCAGGC
CTCTTTCCATTGGCGTTCTATTGCCTCATCTTCGTAATGTGAGGTAATGT
TGCCTGGTTATTCGCTACTGCGCTGCACATCCCGAGGTTCAAACAGCACA
GGATCCTGGATTTATGCAATGATGAAGTTATTGAAGGCTGTGAGAGTGAG
ACGCATAATGCCGCCTTGCACAGGAAATTTTAGTTTTTGGCCAAGTGTTT
TTCGCTAGTGGTGTGATGCTAACTTGGTATGTCGCAAGATGTTCGTAACA
TCACGCACGTTATTAACTTTGATTACCCAAATAACTCTGAAGATTACGTT
CACCGCATTGGCAGAACTGGACGTGGAGGCGCCCGCGGAACCGCCATTAC
CTTTTTCACCACCAACGATGCAAAGCAAGCTAGAGATCTGCTCACTGTTT
TGAGAGAAGCTAAACAACAGATTCCGCCAGAATTGGCTGACATGTCCAGA
TCTGGCTTTGGTGGTGGGGGGGGACGTTATGGATCATCCCGTGGCCGCGG
CGGCCGTGGTGGTGGAGGTGGAGGTTTTACCTCTTCTAACAGCGCACCTC
TTGGGCGCAGCCGGTTCTAGTGCTTTCGCTCGCCATAAATAATTACCG

Sequences in the Contig:

SY0AAA49YL21FM1 SY0AAB11YG15FM1 SY0AAB15YL06FM1
SY0AAC32YO03FM1 SY0AAD8YP07FM1