Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4441
Length(NT) : 665
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4441
TTGGGGTTGAGGAGGTAAGAGGGACGTGGGGACGGCGCCATTATATAGTG
AGGTCCAGGACTTGGCGCCAAGTGAATTTTCGCCGACAATGCCAGGGGTG
GGATGGAGCTTAGGGTTTCGGGTTTATGAAGGGAGGGGCACGAATTGTCA
CTCGGTTTTTGTGAGACCGGATAGAATGTGCCGGGTTATCGTCACCCAAT
CATGGAAGAAAAAGAAAAAAAGAAGTACTTGGATGGAAAAGGTGTGGATT
TTTTTTCTCTCCTGGTGGAAATGTTGAGGAACTCGCCCGGTTCGTGTGTT
AGCCGGTAAGCGGTGGTCGCATCGTGGGGGCTTTTTCGTGCTCTTCTACA
CTTTCAGTTTCCGTCAACGCCGCAGAGTGGGGGATTCTCCCAATACCAGT
GTGTATATTACCTGCTCGTATCATACATACACGAGCGTAAGCTCACTCCG
AACGCACCCGGCGCAATGCAATTATCACAGTGCGAGTGACAACCCATGAA
AACAGCATTTCTACTCGCGTGGCGGCGACTCCGATTCGTGCGTACTTGTA
CTGTACTCGAGTACGATACAGCATTTTCCTTTTCTATCCGGTCGATGAAC
TGGCGCATGTGGCGAACCACGAATAAAATTCCAACTTGGCCAGAATTGCG
AAGCGTGTGCTACAG

Sequences in the Contig:

SY0AAC14YA11FM1 SY0AAC15YH01FM1 SY0AAC20YD13FM1
SY0AAC32YO01FM1 SY0AAC4YL16FM1 SY0AAD47YJ17FM1