Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4440
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00010678001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1425 Score: 221 E_value: 3e-19
PFAM Definition: MFAP1_C, Micro-fibrillar-associated protein 1 C-terminus. This family represents the C-terminus (approximately 300 residues) of eukaryotic micro-fibrillar-associated protein 1, which is a component of elastin-associated microfibrils in the extracellular matrix..
Pfam Number: pfam06991 Score: 165 E_value: 1e-12

Sequence:
>Contig4440
TTGGCCACAATCGCCCACCATGCCTCCAAAACGCATGACCGCAAATCCCG
CAAAGCCCCTGCGTTACCGGCCAGGTAAACCAATTGCGTCAGAAGAATCG
GATTCCGAAGAATCAGAAGACTCTGAAGCTGAAGGGTCCGAAGAAGATCC
TCGACAACCCAGCAAGAAAGCCGCCGCCGAAGCTCCCGCAAAGGTCTCTA
CCGCTCTCCGAAAGGTTGACCTTAGCAAGCGATTCGAAGAAGGCCGCAAA
GAAGAAGAACAACGAGCAGCTGAAGAGGCTAGGAAGCGCGCCGAGGAAGA
GAGCAGCGAATATTCAACAGCTGACGAGGACGAGGAAGAGGAATCTGAGG
AAGAAGAATCTGAGGAAGAGGAAGAGGAAGTTCCGAAAAGAGTTCTTTTA
AGGCCTACATTTATTCCGAAGGGGAAGCGCGGCGTTGTCGCCTCCCCCGC
TCTAGACCCGGAGGTAGAGGCAAAGAAGAAAGCTGAAGAGGAAGCCCGGA
AGAAAGCTGAGGCGGCGGCGCTTCTTGAAGAACACATCCGTCGCGATGCA
GCAGCCAAAGCTGCTGGAAGAAAGGGGTGGGACGACGATGAAGATGATGG
GGAGGGCCTAGATGACACAGACGACCTCGATCCAACCGCCGAACGTGCCG
CCTGGAAG

Sequences in the Contig:

SY0AAA27YB14FM1 SY0AAC32YN10FM1 SY0AAC51YI06FM1