Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4438
Length(NT) : 282
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001537337.1| Score: 127 E_value: 5e-06
KEGG Definition: WD repeat protein
Accession: aor:AO090124000091 Score: 122 E_value: 8e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4438
CACGAATTGAAACTAAGGATGGTATATTTCAAGACCATCAAGTTCCACAA
TATAATGTCACCAATCCCCTCTTCCCATCCTCCATACATAAAAAACTAAT
CAAACACATATCAAATGAAACAAAAAAAAACCACTACAAACTTTTCCACC
ATCAAACTATCAACATTGAAAATCACCTCCCACTCCTCAAAAACCCCACA
ACCCCAAAACAATACCCCACCAATTCCCCCAATCTGCCCCCCTCCCTTTT
CTGTTCTACCATCCATTTCCTCAATTCATCCC

Sequences in the Contig:

SY0AAC28YB18RM1 SY0AAC32YN01RM1