Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4437
Length(NT) : 540
Best Gene Model Blast : Link to GSTUMT00011330001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CIMG_08493
Accession: ref|XP_001241330.1| Score: 248 E_value: 6e-20
KEGG Definition: hypothetical protein
Accession: ncr:NCU07011.1 Score: 233 E_value: 2e-18
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1539 Score: 226 E_value: 7e-20
PFAM Definition: No Hit Found
Swissprot: Q06078|UTP21_YEAST
Gene Ontology:
GO:0005732 = Cellular component: small nucleolar ribonucleoprotein complex
GO:0032040 = Cellular component: small subunit processome
GO:0005515 = Molecular function: protein binding
GO:0006364 = Biological process: rRNA processing

Sequence:
>Contig4437
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCAATAACGACGATAACCAC
GATAGGGCTTCGCAGATCAGTTATTGCGATAGCTACTCACCAAGGCGATC
TTTAATTTTCACAATGACGCTGAACAAACATCGGCGCAAGATAGCCGATT
CAGTTGCGCAGAATCCTCCCGCTCCTCCCACCCATTCGCGTATTCTCGCG
CCTTTCAGGGCAATTGGCCACGTAACGTCTACCTCTGTGCCCCCCGTACC
GTTTTCTATCCTGCCACTGGGGAAGACATTCCAGCTTACGACTGCACTCT
CGAATGCTATACAAACCTACGACGTTCGGCGACTGAACCTTGTATTCGTC
TCATCACCGCCTACTCCCGGGACCATTCGTCGAGCTGTTGCACATCGGGA
TGTGGTGTATGTCGCCTTTGAAGATCCGCTCGTCAGAGTTTGGGTGTTTA
AGAGGGGAAGGAAGGTCGCTGAATTGGCTGTTGCAGGTGAGGGGAGGAAG
AAGATCACCGAATGGCGGGACTTGGTAATTTTCGGGGATT

Sequences in the Contig:

SY0AAC32YN01FM1 SY0AAD63YC23FM1