Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4435
Length(NT) : 294
Best Gene Model Blast : Link to GSTUMT00010874001 E-value : 1e-64
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4435
GAAAGTACGATAGGACAGGCCGTCATTGGTTGTTATATTTGTAATACTCG
AGTACATGGTGCGCTACCCTAAACTATTTACGTGGACCCTCTGAAAAGAA
CCACTTCCCCATTTCACACATCACCAACAACACAAACGCCAAATCGAGAT
AATTCTTCTAAAGCTCCAAATATGCAACTCCACAGGTTTGTGATGGAAAT
GGCTGGACGATTTATGACGGGAGGGGGACACTCCATAAGCGGGGGTGGGA
GTGGAAGGACCGGCTATGAAATTGAAGACCCCGGCGATTTTATA

Sequences in the Contig:

SY0AAC32YM15RM1 SY0AAD18YK13FM1