Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4434
Length(NT) : 1069
Best Gene Model Blast : Link to GSTUMT00006526001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2002 Score: 238 E_value: 8e-21
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 169 E_value: 8e-13

Sequence:
>Contig4434
GATACGATTTCTGTATGATATTCATGAGAGCTACCATGTCAACTACAGAA
TAGTAGCAAAAAAGAAATAGGCAAGGTAAAGAATTAGAGGGAGAGATAAT
AACGGATGTTGGATTAGAGTAAGTGTAGCTGCTATCTACCCATTAACTGG
ACTAACGAATACATCCGCATATTTTTAGATGAGGAATGAGGGGGGGCACA
ATACACGGAGGTAGACATGAAAGCTAACATGAGCAAAGTGAGAAAAAAAA
AATTGAAAAAAAGAAACCTTGACAATTCGATCAATCCTCATCATCGACTC
CAGGAGTAGGAGCTCTGTCCCGCATCTCCACATCCTCACCATCCTTAGAC
CCCCCGATAGTCTTACTAGGGTCGTCCCCGAATAAATCTTCGTTTACATC
CTCCAAATCCTCATCATCTCCGCTATCAATAGCCCTGGCAGGCTTACGCT
TACGCTTCTTACCCCCTTCCTCAGAAGCTTCGGGAAGGGGGACGAGAGGT
GGGGCGGGGATATCGTCGTCATCGTCCTCGTCATCGCTGGGGTTGACCAC
CTCTGAAGACTTGAACTTGCCCTTATTAGTTGGGGATGCTCTACGCGTTA
GCTTTTTGCGCTTCCTAGCTGGCTTCTGTTCGTCGTCGTCTGTGATGGCA
GACTTCGACTTGCTCCTGCGACGAGAAGGTTCGGAGGTGGAGTCGGAGTC
TATTGTTCCGTCCTTCTTACTACCGCGTTTGCGGGTAGATCTAGACTTTG
ACCCAGCAGCTGACGATCTCTTCCGTTTCTTCTCGCCATCAGAGTTCTCC
TCGCGGATGCGTTCTTCTTCTGCCTTCCTCTCTGCGAATTCTCTTGCTTC
TTCTTGCATCTTCTTGCGCTGATCTGCTATAGCTTTGTTACGCTTCTCGA
TCTCGCGTTCTTCTGCTTCTTTGGCTTCCCTTTTGCGTCGGAGGTCTTCC
TCGCGCTTGCGCCTTGCTTCGGCCAATTTGGCTTGGTTCTTCTCTTCGTA
CTCACGTTGCTTCTGAATTGCTCTTTCCATTTGCTTGCGGAAAGTGTTCT
TGCCCATGGTGGACCCCAA

Sequences in the Contig:

SY0AAA13YG04FM1 SY0AAC21YM10RM1 SY0AAC32YM11RM1
SY0AAD13YO12FM1