Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4433
Length(NT) : 1369
Best Gene Model Blast : Link to GSTUMT00000752001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1295 Score: 132 E_value: 2e-08
PFAM Definition: TFIIF_alpha, Transcription initiation factor IIF, alpha subunit (TFIIF-alpha). Transcription initiation factor IIF, alpha subunit (TFIIF-alpha) or RNA polymerase II-associating protein 74 (RAP74) is the large subunit of transcription factor IIF (TFIIF), which is essential for accurate initiation and stimulates elongation by RNA polymerase II..
Pfam Number: pfam05793 Score: 143 E_value: 1e-09

Sequence:
>Contig4433
TTGGATAGGGTCATTAATTGCTTAATAATTGGGGAGAATTATGCCTCGGA
AAAATCACATTGGTTCTGGAAAGCGCCGAAGGGATCAAGTGGGATTTTTG
GAGCATTATTATTTCTCGACATGATACTAAACGCTGAATCAAACTACCTT
AGGTTTCGCTTTCGAGAAAACGGTCAAAGAGAGGGATTTGGAAAAAGAAA
AACAAGCACTGGCAGAACTCCATAAACCGCGCTGGTTTCCCCCCGCGACC
AGAAGGGCCCCGATCGTACCATAATGGTTGTCACAGTTGGGCTGGGTTTT
GCCGAGACACCACAAGGGCCCAAGCCAACGCCAAGCCTCTCCTACCTTGC
TGTGTCAACTGGAGAGCAAGAGAAAGGAAAACTTACTTCTAAACAAATTC
CCTTTTTCCTTTTCCCCCACGGGCTCACGCCGATACAGCAGCCGACCAAC
TCGCCTTTCATCCAAGAATGACTGCACGGCCAGACGCTCCGACTGATGTA
AAGCGTCAGGGTTTGAGAATGATGGGCCCTTCGTCTCTATCTGCGGTGAA
GAGAAAAGCGGATGAATTGGAGGAGCAAGTCACGAGTGTCAAGCATGGGG
AGGAGGAGAACCATGGGAGCACAGAGACGAACAGAACAGCTAAGAGGAGA
AAGAAGGAGAAGAAGAAGGAGAAGAAGAAGAAGAAGGACAATGGGTCTAA
AGGGGACAACGAAGATAAGGGCAAAAAAGAGACCTTTATGGAAGTCACTA
CAAGGGTGGAGGAGTCTTTGGATGAAAATACTCACGCTAAGGGTTTGGAA
GGTGAACCCGTTGACAGTAATAAAACCAGTGATTGCGGCACCTCCGCACT
AAAGCAGAAGAAGGAAGAGGAGAAGGATAAAAAGAAGGGTAACAAAGATA
AGAAAGGAAAGGTATTGAAAAAGGACCAAACGCAAACGCAATCTCATCAC
GAAATGCCCGACGACCAATCGGACGGTAGGAAGCGCAATGCTAGGAGTTC
ACCAGACGAGGAGAACAGCGAGAAAGACAAGAAGAGAAAGAAGGCGACGA
GTTTGGAGGATGTAAAAGAGCAGGAAAAGAAGTGCACCACATCACCATCA
CCGCCACCACAGCCAGAAAAACACCATACCACTCCTCCCTCAATCAAAAC
CGTCACGACTCCAAAGTCCCTCCTCAAGAAGTCCAACAATAAAACTCCCA
CCCCGCGCACAAAGACAGTCACCTTTGCTGACGACGCCAAGTCCACAGAC
GGTGACTCAATCGCCAACACAATTCGTTCCCCCGGAGGTACCGGTGGCAG
GAGTAATATTCCGCGCCTACCGGTATCCCCACAACCCCATCCAGCACTGC
TGGAGCAACAGTCCTTCTC

Sequences in the Contig:

SY0AAA29YD08FM1 SY0AAA37YF09FM1 SY0AAB18YB03FM1
SY0AAC32YM07FM1 SY0AAC34YJ23FM1 SY0AAC34YJ24FM1
SY0AAC58YD12FM1