Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4431
Length(NT) : 392
Best Gene Model Blast : Link to GSTUMT00010829001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An09g05010
Accession: ref|XP_001393813.1| Score: 447 E_value: 4e-43
KEGG Definition: hypothetical protein
Accession: ang:An09g05010 Score: 447 E_value: 2e-43
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1289 Score: 364 E_value: 4e-36
PFAM Definition: AA_permease, Amino acid permease..
Pfam Number: pfam00324 Score: 137 E_value: 8e-10
Swissprot: P19807|HNM1_YEAST
Gene Ontology:
GO:0015220 = Molecular function: choline transmembrane transporter activity
GO:0034228 = Molecular function: ethanolamine transmembrane transporter activity
GO:0015871 = Biological process: choline transport
GO:0034229 = Biological process: ethanolamine transport

Sequence:
>Contig4431
AAACCCCTGTCCCTAGCAAAACTCCACATCAAACGGCTCTGCCATGTATG
AATGCTCATTAAGCACCCAATAGCAGTGAGAATAACGAGCACTTCCAGAA
ACACCGCTCCTGGGACATTTCCCCTAAGTGCTTGCCGGAACAGTTCCAAG
ACCGGTACCGTAGTTGGAGTAGTAATCACACTTTTAATGTCCTGCATAGA
GAAGAATATGGCTATGCTATAAACCCAAGATGTAATAAACCCGATCGCTA
CGGTACCCATAATTGCCTTAGGAATATTCTTTTCCGGATGCGGGATCTCT
TCTGCCATATGGACGCATGAATCCAGACACGAGAATCCCCAATTGACCCC
AAGAAGGCCGAGAATCCAGGCGACTGCATCATTATTCCAGCC

Sequences in the Contig:

SY0AAC32YK13RM1 SY0AAC32YK20RM1