Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4430
Length(NT) : 924
Best Gene Model Blast : Link to GSTUMT00006347001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein MGG_04585
Accession: ref|XP_362140.1| Score: 590 E_value: 4e-59
KEGG Definition: hypothetical protein [EC:3.1.22.-]; K08991 crossover junction endonuclease MUS81
Accession: mgr:MGG_04585 Score: 590 E_value: 2e-59
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2379 Score: 487 E_value: 1e-49
PFAM Definition: EME1, Crossover junction endonuclease EME1. EME1 is an essential component of a Holliday junction resolvase. It interacts with MUS81 to form a DNA structure-specific endonuclease..
Pfam Number: pfam09434 Score: 163 E_value: 3e-12
Swissprot: Q4INS6|MUS81_GIBZE

Sequence:
>Contig4430
ACCTCTAAAAGTAAGATAGCATAGCACCTGTAAATGATTATAAGAGATAA
GCTCCTAGAAATGCATAGACCAAATATAATGAAGGAGAAAAAGTGAAGAC
ACTAGAGCCTAGCATCAACTAAGAATGCCTAACCATACTCCGTAAAGGGA
AAGGAAATGAAAAAAATACACTAGTTCTACCTAATCACTATCTTCAGCCT
CCTCATCAGGATCCGCTTGGGCCCCAACCCCAGTCCATACCTCTGCCACC
TTTGCCGAGACAGCCGGTCCGACCTTTTTCCTTCCAAGAGCGCTTGCGGA
CTGCTTCATGATCATCTCCTTCATCTCATCCTCACTCGCACACCGCTCAT
AAGCCTCGACCAGTTCGATGGGGGTGGGATACGCCTTTTGAATCTGGAGC
GCCTTGTCTAAGCTAATGCCCCGAACACACATAAGCATTTTCAGGTATAC
GTCTCTGAGGTTCAGGCTGGCGCTCTTAGAGACTAAGGTTGAGAAAATAG
AGTAATTTATGTTGAACTGTTTTTCGGGGAATTTCTCATTCAGGTGCTTG
CGAAAGGCTTGGTATGTGCTCGAGTCAAGGAGATTGTCTGGGATCAGGCT
CAAATCCTTGGTCTCGTACTCCTTTTCTAACTTCTTCGTCATTCTGACTA
GGTATCGTATAGTGTCATCCAGTTTGCCTGTCCTCTTGACGAAAAATCCG
TCGACAACCTGTGTAGAACTGATCGCAGTATTCATAGCGTCTTGCATTGC
TCTATCGGCCTCTTTAAGTGTGAAATCCTCGATAATGTAAATCACATGTT
TCAAACCACTCTTCGCTAACCGGAACTTCTGCTCGTGGAACCGCCCATCT
TTGATAGAAGCAACTAGGTCGTCAAGTCTTTTCCGCTCGGCAATGTGATC
CAAAGCAATTTCACGATTACCCAA

Sequences in the Contig:

SY0AAB52YN09FM1 SY0AAC32YJ21RM1