Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig443
Length(NT) : 623
Best Gene Model Blast : Link to GSTUMT00007214001 E-value : 1e-103
Numbers of ESTs : 2

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 540 E_value: 1e-53
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 462 E_value: 7e-45
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0508 Score: 262 E_value: 6e-24
PFAM Definition: No Hit Found
Swissprot: P57078|RIPK4_HUMAN

Sequence:
>Contig443
TTGGAACGAGGGGATGTCAATCCCGACCGCGCAGACACCTTCTATGGCCA
GACACCACTCTCGTGGGCTGCTAAGAGCGGGCATGAGGGGGTAGTAAAGA
TTCTTTTGGAACGAGGGGATGTCAATCTTGAGAAGGCGGACACCATATAT
GGCCGGACGCCACTCTCGTATGCCTCTAAGAACGGGCATGAGGAGGTAGT
AAAGATTCTTTTGGAACGAGGGGATGTCAATCCCGACCAGGCGGACACCT
TCTATGGCCGGACGCCACTCTCGTATGCCGCTGGGAATGGGCATGAGGAG
ATAGTAAAGACTCTTTTGCATCGTGGGGATGTCAATCCCGACCGGGCAGA
CACAAGATATGGCCAGACGCCACTCTCGTATGCCGCTAGGAATGGGCATG
AGGAGATAGTAAAGACTCTTTTGCATCGTGAGGATGTCAATCCCGACCGC
GCAGACACCTTCTTTGGCCAGACACCACTCTCATGGGCCGCTGGTAACGG
GCATGAGGGGGTAGTCAAGATTCTTTTGGAACGAGGGCATGTCAATCCCG
ACCGCGCAGACACCGAATATGGCCGGACGCCACTCTCCTATGCTGCTGAG
AACGGGCATGAGGGGGTTGTAGA

Sequences in the Contig:

SY0AAA24YC13FM1 SY0AAA24YC13FM2