Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4429
Length(NT) : 892
Best Gene Model Blast : Link to GSTUMT00004087001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4157 Score: 131 E_value: 1e-08
PFAM Definition: Nop53, Nop53 (60S ribosomal biogenesis). This nucleolar family of proteins are involved in 60S ribosomal biogenesis. They are specifically involved in the processing beyond the 27S stage of 25S rRNA maturation. This family contains sequences that bear similarity to the glioma tumour suppressor candidate region gene 2 protein (p60). This protein has been found to interact with herpes simplex type 1 regulatory proteins..
Pfam Number: pfam07767 Score: 116 E_value: 8e-07

Sequence:
>Contig4429
TTGGGCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTCAAAGT
TGTCCCCCACGTCCAAGCTTCTCATTTCTAAGCACCAGCAAGTACAACTC
CTCGAAGCAGCCTCAATATTAGTTTCAATGAACCCAACAACAACCCCTCC
GGCTTCATCGTCGGGTGCATCAAATAACGAGGGTAATTCCTCAACAAATG
ACAGTTCATCTAGCTCAGACGATACTACGCCTCCACCATCAGTGTTTTCG
GGATCAGATGTAACAAGCCCATTACCTACGCCCCGAGGGATCCGTAACGG
AGCTGGCAAACCAGGAAAGAGATATTCATCAGGGTCACATTCACGGTCTT
ATCAAGCTCCAAGCGGGAGCGGAGCCTTGGCAGGAAGCGCACCCAATTCA
ACAGCATTCCCTAACCACTTTCCTCATCACCGGCCTTCAAGACCACGTGC
CGGGAGCTCTGCTGGCAATATTAGAGGATCACACATGACTTCCCCGGCTA
CCAGGCCGACAAGTATAACTCCGGAAGATGAAGCGCTTGCTGCGGCCATC
GAGCTACTGAGCTGTTCGTTCAACACTCCAGTTATGGGACCCACTGTGCC
ATTAGGGAGTGTCCCGAGAGGAATTGCTGGGCTGAGCTCTCCACCCGTTT
CCGGAAGGCCAGGTTTCTTGGGACCTCCGTTAAACGATGTCGTGGAGATG
AAAAGGGAAGAAGGAGAAGAGGGAGATGATGTACGGATGGAAGATCTAGA
AGAGCGAAGGAATGTGATGATGGAAGAGGATGATGATGAGGACGAGGAAG
AGGATGATGATGATGATGAGGAGGAAGAGGAAGAGGAGGAGGAGGAGGTA
TGGAAAAGGCGAGGGAGAAGTGAAGAGGACGAGGACGGTGTC

Sequences in the Contig:

SY0AAB33YM13FM1 SY0AAC32YJ20FM1 SY0AAD21YI17FM1