Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4428
Length(NT) : 1251
Best Gene Model Blast : Link to GSTUMT00003080001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4428
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAAAGAGGAAGTACAGCCC
ATTCATAGGTTCTGAACATTGGACGCTACCCACATTCTTCGAGAGACCCC
CACGCGAGTGGGGATTCCGCGCATATTCGGAAGACGGCCGTGATGATCTC
CTATCATGTCAAGTACTTGATGGGTGGACAAGATCGTTGGAATTCATTGT
CAACCCTCACAACAAGCAATCAGTACAACGGAAGAATCGCGCGTCACAAT
TACTCGCCGATTATACACAGGGGGCCGAAGGATCCGATGATTTTATCGAC
CGTCCAGTCATTGCGAACAAAAAACCAAAGCAACCCTCAATCTTAATCTC
ACGTTGTATTGGGCTCGATGTGGTAGCGCCGGTATTTGACCGGGGATCTC
AACGCGATACCACAGCCCGTAATTTAACAGGTGATTCTGTTTCAAAGAAG
CAATCAAGGAATACATTATTCAATCCTCGGATTACGGTTGGCAGTGGCCG
TGGCACCCGGGAGCCGGAACGAGGTGACGAGCATCATGCGGAGGAAATTC
CCCAACCTAAGGAGGCTGGTCGAGACTCGCTTCCGGATTACTTCCATGCT
GCATATGACAAGATGGACAATGAGCACAAATGGGAGCTTGCTAGCGGCCG
TTGTGTGGAAAATGTCATCTATGAGGCTTGCCAGGCGATGGAGTCAAACG
CATTTGCCTATTCTCCTGCTCAATTGTTCATCCTCGATACAGCAGATCCT
GTGGTCGAGGGCTGGTTTACGGAGGATGAATGGGACGAGGTAATGGGGAG
AGTTTCACCCCTGCCAGGTGTCGACGAAATACTAGTGGATTCATTCGAGA
GATTCTATTACGTTGAAACCACCGCCATGCTCGGCAAAGCCCTTGATTCA
CGTCTGATAAGAGATGATGGTACCTACGATAAAACCCTTCATTACAATTT
GCTATGGGCCGAGATGGCCATTCGTGAATTCTTAACGTTCTTCGAAGGAC
CAGACAACCCACTTATCTCGACACATTCAGAAGGCTGGTACGTCAATAAC
ATCTGGTCCCATATCCTTGACGCTAGCCTCCGCGACCTCCACGGCCTGAC
GGTAGATCGCGGGGAAGGCACATGTCGTGCTACGGCCCTGCGCATGAACT
GCCAGCGGATAACGGTCACCGAACGGTTGAAACACGGGCCCCGCCACGAC
GGCATTATCCGTGACTTAGGGGACGATTATCACGAGTACGGCGTGATTGA
A

Sequences in the Contig:

SY0AAC32YJ13FM1 SY0AAC57YJ21FM1 SY0AAC8YG05FM1
SY0AAC9YC01FM1 SY0AAD47YD17FM1