Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4427
Length(NT) : 1374
Best Gene Model Blast : Link to GSTUMT00010809001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0199 Score: 151 E_value: 1e-10
PFAM Definition: HPC2, Histone promoter control 2 (HPC2). HPC2 is required for cell-cycle regulation of histone transcription. It regulates transcription of the histone genes during the S-phase of the cell cycle by repressing transcription at other cell cycle stages. HPC2 mutants display synthetic interactions with FACT complex which allows RNA Pol II to elongate through nucleosomes..
Pfam Number: pfam08729 Score: 135 E_value: 1e-08

Sequence:
>Contig4427
TTGGCTCGCTCTCTCCACAATCCAGCACGTGGCGGGGATGTCCAATTTCA
GCGGAACACAAGATCGAGTTCTAAGGCTGCAAAATTGAGTTTGTCGGATC
AGCTCCAAAAGGAGTCGGAAGTCAAGGACTCCGATCAGCCATCACCGGGC
ACTGCTTCTGCTGACGTTCATTCGTCCCCACCAAAGAGGCGGCGTTCAAC
CGGAGGACTGTCTAGGGCTAAAAAGCGGCTTGCGAAGTCAACCAACCCCG
CTAGCAACCCACAAGCATCGACTTCTCAAAATCAGCAGTCTAGTTTGAAT
GCCTCCAGTACAAGTATGAGACCACCCCCTCGGGATCAAATGGACATTAC
TACCCCTAAAGCATTAGCGACTACATGTGCGCTTGCCGAAAACGATCCTT
TGGAGCCAAGTTCCGTCAATGATGCCATGGATATGGACCCGCCTACCACT
AATGGCGCTGAGGGTAGTGCGCAAGGCACAGAGCCTAATGATCTCTCTAT
AAACGAGGGATCTGTTATAGATAAAGCGAACGCTGGGAACACAGTTTATG
CGATGGACGAAGTAGACATCCTTCTTAAAGCCGTTATGGATGTTTACGAT
TCTGCAGAGGAACAATCCGCTCCCCGACCTATGAAATCCCCTACACTCCC
TGTGGATGGGCCGGAAGGAGGCGATACGGCCAATCGAGGAATTGTACCCG
TTACTCTTGCTAACACGGCCTCACCTCCGACATCTAATGGGGCTGAGGGT
GACATTAGTACCCACGGTAGCAAGAGTTTAATCGCCAAGCCCATGCCTGA
AGAGACTCTAGCCGGTCCTCCGCCTAATCGCTCTCCTACACCCGTGGTTG
GCGAGCCTAGAGCAGAGATCAGGACGGACACAGGAGCCGAGCCTGCTACT
ACTACAAAACCTCAGTCCCCGGCCCCAAAAGACAATGAGGGTGGTGGTAT
CATAGAGAAAAAGAGTTTAATCGTCAAGCTAAAGTCTAAAGGAATTGCTG
TACTTTTACCATCTATTACCGACAGTGACGCAACGAACCGGCTCTACGAC
ACTTCAGACCAAGCTTCTGATCAAACCCCAAATCATTGCTCAAACCAATC
AAAGCCAAAACCTGTCTGGCCAGTTCCCCCGCCTCCGCTTTCGGCATCCC
CCCCAGCCACGAAAATTCAGTCGGTCCCCCGCCCACCTATCTACCGCAAA
CCAGATCCCCCAGCCCCGAAATCCGCCGAAAACGCCAAAACCACTCCCAA
CGATACACCTTGGGCACCCAAACAAGCTATTTCAACAACTACCTCAAGTC
CAAAGGCTGGATCGTCCGGTGAGAAGCTATCCCCTGAGCCTTCAGGCCCC
CTAGTGGCTAGTTCAGATGCTTTG

Sequences in the Contig:

SY0AAA30YD06FM1 SY0AAA38YJ06FM1 SY0AAC32YJ07FM1
SY0AAD10YO03FM1 SY0AAD6YC08FM1