Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4426
Length(NT) : 3644
Best Gene Model Blast : Link to GSTUMT00002747001 E-value : 0.0
Numbers of ESTs : 157

Blast Results:

Nr Definition: sulfate adenylyltransferase
Accession: ref|XP_001246683.1| Score: 2373 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU01985.1 Score: 2339 E_value: 0.0
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0636 Score: 1048 E_value: 1e-114
PFAM Definition: ATP-sulfurylase, ATP-sulfurylase. This family consists of ATP-sulfurylase or sulfate adenylyltransferase EC:2.7.7.4 some of which are part of a bifunctional polypeptide chain associated with adenosyl phosphosulphate (APS) kinase pfam01583. Both enzymes are required for PAPS (phosphoadenosine-phosphosulfate) synthesis from inorganic sulphate. ATP sulfurylase catalyses the synthesis of adenosine-phosphosulfate APS from ATP and inorganic sulphate..
Pfam Number: pfam01747 Score: 1081 E_value: 1e-118
Swissprot: Q1EAF9|MET3_COCIM

Sequence:
>Contig4426
TTGGACTGCACTCACTCTGGCGGTGGTAGAGTCAGGACTCAGGATGGGAT
CACTCGAGCACTGTGCTACTCAGAAAATCATGATAAGGCTAGGCTAGAGG
TGACAAGAAGCATGAGGCATGTATGAGCGGTGGATTTCAATCCTTGCATG
CAATGGTGCACAAAAAGTCAAGTGCAGAGGGGGTATTCGGGGCAAAGCTC
TACTTATCTCTCAAACTTAGCCTACAACTTCGGCCTAGCCTTGCTCGCCA
CTTTCGAGATAACGCGGTGCTGGACACCTGGGAGGTAACGAGTGGAGAGA
TTATAGATAAACTGGCCATACGGTCCACCCCTTGCAAGAATCTAGGCTGT
CGATGACCAGTACGAGTGATGCTGCGGAATTAACCAGACTAGCGAATCTC
ATCTATGAACAAGAGGTGAAGCAAAGTGAAAAAAAGAAAGAAAAAAAAAG
GAAGAAAGAAAGGGCGGAAGTTTAGGTTCATCTACTTCGATTCGATGGTC
ATTAGCAAAGCTCCGCAAAAGTAGTGTAGAGAGAGATCTCACCCAAGCTC
CTTTTGTCGCACAATGCCTCCCCTTCTACCCTTCTATTTTCCGTGTCCAA
TAGTCAGCTCTGATCAGACTTTACGCCTCATACAAGGGGAAATACCAAAG
CACCGCCCTCGACGACCAATCTATCCATCTGGAAGAACTGGCTAATCATG
GTCTGTCTCTAGATACCCCGAGCCCTAATCAGCAAACCGACTACCGGTGC
ACGCCCACTCTAGTGGCGCCATCGCCATCAACCGACAGTGGTTGGACGGA
CCTTTAACACCTGAAGCTCCTTCAATCCCTTCTGCATAAGCTCCTGGATT
TTCCTCGGATCCTCAACGTTCTTGTGTTCCCGGAAGACATCCCTAGTCCT
TCGCCTCGCGTACTCACGGAAGTTGTATGAGGAAAAACGATCGGAGAAGC
GGAGAAGATTGCGGTACAAAGACCTAGCTTGAAATGCCGTATCAGCCATA
ATAGAACACCACCGATGAACAGCGATGATGCCGAGCAGGGTTGTTTTTGC
GGAAACCAGATGAGATCCCCACACAACGCCAAGAGATACAGTATTACACC
ACCGGTATCTGCGCTCACTTTCTTTCCAGGAACAGATAAAGGGGAAGTGG
AAGAAGGAACGAGGCTTTCTCAACCCCTATCAGGTTTTGTGCCCCGCACA
GCCCCACTAATATTGCCCCTCCAAACCAAGTTAACCCAACCCCAATCCCT
AACAAAGTGAAAAAATTGGGGAAAACGATCCCCGGTCCGCACCCCGCTAT
TCACCCCGCTATAATACGTAAAAAAAATGAGACCCTCTCTCATTAACTTA
TATCCTGGGTGAATAATGGCTTATCGCTGGCAGTGCGGCTTCGGAAGCCA
AGGCGGTCGGAGGGGCGAGCTGGGATAGTTTGCAATTCGGGAGCAAAATC
ACGTCATTTGAAGGGAGTTGTTTCTTGGTGAATTTTTTTTTAATTTTATG
GAAACATGAACTTAAAGGGCGTGTCCCTTTCCCTGCGAATACTCCTGTCC
ACCGTTGGCACACCCCAGTTGTCAGGGCATATTATCTTTGGTTTCTACTC
TGATCCGTTAATTACTCTTCCCTTATCGCCAGAATGTCGGATTTGCCGCA
ACCCCATGGGGGTGTCCTCAAGGACTTGATTGCTAGGGACCTTCCTAGAC
ACGCTGAACTCCTCGCTGAGTCTGAGACTCTTCCAGCTTTGATTCTTACC
GAGCGTCAACTTTGTGATTTGGAGCTGATTCTGAGTGGCGGATTCTCTCC
TTTGGAGGGGTTTATGAACGAGAAGGATTACAATGGAGTTGTTGGGAATC
TTCGTCTCGTGGATGGAACACTCTTCTCCATGCCTATCACTTTGGATGTT
TCCAAGGCTCAGATCGAGGAATTGGGTGTCGAGGTTGGTGCGAGAATCAC
GCTCCGTGATTTCCGTGATGACCGCCACTTGGCCATCATTACTGTCGACG
ACGTCTACAAGCCTGACAAGCAAAAGGAGGCCAAGGAGGTCTTGGGCAGT
GATGAGGAGCACCCTGCTATCCGCTATCTGTTCAACACTGCCCGGGAATA
TTATGTTGGTGGGAAGATTGAGGCCATTAACAGGCTCAATCACTACGACT
ACGTCGGCTTGAGATACACTCCCGCCGAATTGAGGTTGCACTTTGAAAAG
TTGGGATGGTCTAAGATCGTTGCGTTCCAGACCAGGAATCCCATGCACAG
GGCCCACAGAGAGCTCACTGTCCGGGCAGCCAGAGCGCGCCAGGCAAACG
TCCTTATCCACCCCGTTGTGGGTCTCACAAAGCCGGGAGACATTGATCAC
TTCACCCGTGTTCGCGTCTACCAGGCTCTCCTCCCCCGATACCCCAACGG
CATGGCCGTCCTTGGCCTTCTCCCCCTTGCTATGCGCATGGGAGGGCCTC
GTGAGGCCATATGGCACGCCATTATTCGTAAGAACCATGGAGCCACTCAC
TTCATTGTGGGAAGAGACCACGCCGGCCCCGGAAGCAACTCCAAGGGCGT
TGAGTTCTACGGCCCTTACGATGCTCAGCATGCCGTTGCGAGGTACAAGA
GCGAGCTAGGAATTGAGGTTGTTCCGTTCCAGATGATGACATACCTCCCC
GACACCGATGAGTACGCTCCTGTCGATGAGATCAAGCCGGGAACCAAGAC
CTTGAACATTTCCGGAACTGAACTCCGTCGCCGCCTTCGCACCGGAACCC
CCATCCCAGAGTGGTTCTCATACCCCGAGGTCGTCAGAGTTCTTCGGGAA
TCCCACCCACCCCGTCACAAGCAAGGCTTCACCGTCTTCCTAACCGGGTA
CACCAACAGCGGCAAAGATGCCGTCGCCCGCGCCCTACAAGTCACATTGA
ACCAGCAGGGCGGCCGTTCATCCACTCTCCTCGTCGGCGAGACCGTCCGT
TCTGAGCTCTCGGCAGAGCTTGGCTTCTCCCGAGAAGACCGCCACAAGAA
CATCCAGCGCATCGCCTTCGTTGCAGCTGAATTGACCCGCGCTGGTGCCG
CCGTCATCGCCGCGCCCATCGCCCCATTCGAGGACTCTCGTGTCCAGGCG
AAGCAGACCATCGAGCAGTTCGGTTCAGCGTATCTCATACATGTCGCTAC
GCCGTTGGCGTACTGCGAGAAGACGGACAAGCGCGGGGTATACGCGCGTG
CCCGCAGTGGCGAAATCAAGGGGTTTACTGGCGTGGATGATCCTTACGAG
GATCCCATCAAGCCTGACCTAGTTGTGGATGCTAGCAAGCAGACTGTCCG
CAACATTGTCCACCAGATCGTCCTCCTTCTTGAGAGTGAGGGCCTTTTAG
ACAATATTTAGATAGACTCGCTTCTAGTTTTGGCTTTTCTTTTCTTTTCT
TTTCTCTCTTTTTCTTTTCTGTTTCCGTTTTCTTTATCATTCCTATAACT
GCGTTGCACTTGGGATCCATTTATTTGTGACTGTTAGATTTTCCAACGGA
GTTTTCGTGTTCGTCTTGTGTGCGTGATTATGTTCGGGATATAGGCATGA
ATGCATGTATGTACTGCTATGATATAAACAAGCTCTTTAGCCTCCCCCCC
TCAGTCACGATATCTCACCCAATATCAAGCATCGGTTTACCACT

Sequences in the Contig:

SY0AAA1YL21FM1 SY0AAA32YJ22FM1 SY0AAA63YI07FM1
SY0AAB19YI02FM1 SY0AAB26YK03FM1 SY0AAB26YL03FM1
SY0AAB27YC23FM1 SY0AAB52YJ14FM1 SY0AAB59YI21FM1
SY0AAC10YF18FM1 SY0AAC10YK22FM1 SY0AAC11YE09FM1
SY0AAC12YP19FM1 SY0AAC13YL15FM1 SY0AAC14YE10FM1
SY0AAC14YF11FM1 SY0AAC15YC11FM1 SY0AAC16YC21FM1
SY0AAC16YF16FM1 SY0AAC16YJ12FM1 SY0AAC19YG20FM1
SY0AAC1YH19FM1 SY0AAC20YK19FM1 SY0AAC21YJ01FM1
SY0AAC21YK20FM1 SY0AAC21YK20RM1 SY0AAC22YD06RM1
SY0AAC22YG18FM1 SY0AAC22YH04FM1 SY0AAC22YI11FM1
SY0AAC23YN07FM1 SY0AAC25YP09FM1 SY0AAC28YH03FM1
SY0AAC28YH03RM1 SY0AAC28YK02FM1 SY0AAC29YB08FM1
SY0AAC29YB15FM1 SY0AAC29YC08FM1 SY0AAC29YN18FM1
SY0AAC30YH05FM1 SY0AAC31YK02FM1 SY0AAC31YO18FM1
SY0AAC32YJ04FM1 SY0AAC33YO13FM1 SY0AAC34YH01FM1
SY0AAC34YO04FM1 SY0AAC35YA06FM1 SY0AAC35YA20FM1
SY0AAC35YB11FM1 SY0AAC35YE21FM1 SY0AAC35YG12FM1
SY0AAC35YP01FM1 SY0AAC35YP08FM1 SY0AAC36YA06FM1
SY0AAC36YC13FM1 SY0AAC37YO09FM1 SY0AAC38YC10FM1
SY0AAC38YJ19FM1 SY0AAC39YE19FM1 SY0AAC3YL22FM1
SY0AAC40YJ20FM1 SY0AAC41YH13FM1 SY0AAC42YF12FM1
SY0AAC43YI21FM1 SY0AAC43YL16FM1 SY0AAC43YO19FM1
SY0AAC44YD16FM1 SY0AAC45YE05FM1 SY0AAC45YI12FM1
SY0AAC45YJ21FM1 SY0AAC46YL18FM1 SY0AAC49YC03FM1
SY0AAC49YF23FM1 SY0AAC49YN21FM1 SY0AAC49YO20FM1
SY0AAC50YC17FM1 SY0AAC53YF20FM1 SY0AAC53YL16FM1
SY0AAC55YD18FM2 SY0AAC55YG07FM3 SY0AAC56YB06FM1
SY0AAC56YM03FM1 SY0AAC56YO10FM1 SY0AAC58YI15FM1
SY0AAC59YL11FM1 SY0AAC5YB13FM1 SY0AAC5YE21FM1
SY0AAC5YI19FM1 SY0AAC5YN23FM1 SY0AAC60YA19FM1
SY0AAC60YF03FM1 SY0AAC60YJ14FM1 SY0AAC61YK04FM1
SY0AAC62YF02FM1 SY0AAC6YM21FM1 SY0AAC7YG18FM1
SY0AAC8YG03FM1 SY0AAC8YL14FM1 SY0AAC9YG17FM1
SY0AAD10YM23FM1 SY0AAD12YB22FM1 SY0AAD12YH13FM1
SY0AAD19YG24FM1 SY0AAD22YH03FM1 SY0AAD23YD24FM1
SY0AAD23YH18FM1 SY0AAD23YL08FM1 SY0AAD24YL08FM1
SY0AAD25YA01FM1 SY0AAD26YI15FM1 SY0AAD28YK12FM1
SY0AAD29YD06FM1 SY0AAD30YO23FM1 SY0AAD32YD07FM1
SY0AAD34YC07FM1 SY0AAD35YE11FM1 SY0AAD3YA18FM1
SY0AAD40YA09FM1 SY0AAD40YC02FM1 SY0AAD40YJ19FM1
SY0AAD40YK20FM1 SY0AAD40YN10FM1 SY0AAD41YI09FM1
SY0AAD41YJ05FM1 SY0AAD42YE19FM1 SY0AAD43YD15FM1
SY0AAD43YH11FM1 SY0AAD43YP05FM1 SY0AAD44YD17FM1
SY0AAD44YJ09FM1 SY0AAD44YL24FM1 SY0AAD45YA14FM1
SY0AAD45YD02FM1 SY0AAD45YL14FM1 SY0AAD46YA14FM1
SY0AAD46YB14FM1 SY0AAD46YL18FM1 SY0AAD47YC12FM1
SY0AAD48YA09FM1 SY0AAD48YG21FM1 SY0AAD48YL14FM1
SY0AAD4YO22FM1 SY0AAD51YN01FM1 SY0AAD53YP01FM1
SY0AAD55YB14FM1 SY0AAD56YE06FM1 SY0AAD56YH22FM1
SY0AAD59YC01FM1 SY0AAD61YB01FM1 SY0AAD61YF12FM1
SY0AAD62YP09FM1 SY0AAD63YB23FM1 SY0AAD6YF11FM1
SY0AAD6YJ05FM1 SY0AAD6YM09FM1 SY0AAD7YB15FM1
SY0AAD7YP17FM1