Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4425
Length(NT) : 1551
Best Gene Model Blast : Link to GSTUMT00007157001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_00383
Accession: ref|XP_001598297.1| Score: 461 E_value: 8e-44
KEGG Definition: hypothetical protein
Accession: ncr:NCU03486.1 Score: 414 E_value: 1e-38
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4425
CTGTCACAATGGCTTTGTCGCCCGCGATCTTTCCCCACACCATCGCCGAA
AGCAATTGCCTATGATACAGCAAAAGTTTAAGTTCGAGAACATTTAAGTA
GGTCTTCCCCCCTCACCCCCTTTCCATTCATCCACGCCAACCCTGGCCCC
TATGCAACCCTTTAACACTATTCAAAAAGTGAAGCGAGATGGATCCTGAA
GATTCGACAAGACGACTTGAATCTTTGAAGAAAGTCAGCAAAGACTCAAT
CGAATTCGTGCAAGAACTATTGGAGGAAAACAAAAAACTCGGCAAAAATC
TTGCAGACATGCGGGTGATTCACAATAGCATGGTTGCGACCTGTCGAGAG
TATGAACAGCTACAGTTAAAGTTTAAAGAAGCAGAACGCCTTTTGAGTAA
CAACCAATACATTGTCGTCCTAGTTGACGGTGATGGAATGATCTTTGCAG
AAGAGTTGCTAGTTAGAGGGAAATCCGGCGGGGCGGAGGCTGGGAGGCTG
CTTATCCAAGCTTTAACTGAACTTCTTGTGGCAGAAGGCACGCCGGAGGT
ACATGTCATGGTTTTCGTCAATATGTATAAGCTTGCAAACGTTCTCCAAC
TTTCTGGTCGAGTTAAAGAGCCCAAGGTTTTTAAAGATTTCGCTAAAGGA
TTTATCCAAGCCAAAGAACACCTCTATTTCATAGACGTCGGGGATGGAAA
AGAGATGGTAGACAGTCGTATTAGAGCGGAATTAAACTTTCATTTACAGA
ATTACAACTGCCAAAAGGTTGTGCTTGGAGCCTCGCATGATAATGGATAC
GTCCGAATCCTAAACAGCATACAATCTTCCGCCACACCCGACGAGAGTAA
GGTTTGCCTATTGGAGGGTCCCCCGTTCGCCAGCGAATTTCAATCTTTAG
AGTTCGAGACACTCAAGTTTTCTCACATCTTCGATTCCCGGAAATTGGAG
ACTCCCCGTCTGCCCCCAGGGCTGCCGGTCCCATCCAGGCCTGTAGATGT
ACCGAACCCGTACCCACAAAATCCGGTATCGTACGCCGGTGCAGTTGTGG
CACCGCCGCCCCCAGCAACTGCATCGAGACCAGCGAACACGGCCCAGGTG
GGGCTCGGGAGCAGGATTAACATTATAACTCCGCAGCAAAAGGCAGCAAT
GACCAAAATTAAAAGTTTGCAGCCGCCACCTTGCAACGACCATTACATCC
TCGGACAGTGCTGGAAAGAGCCATGCCATTTTTCACACAAGTATAATCTA
GCGCAGGTGGATATTCAGGCGATGCAGAGTAGGGTCGGCGCTACCCGGTG
TGAATTCGGCGAGGCATGCCGGAACGAAAACTGTTATAGGGGCCACTATT
GCAGCGCAATTAGGGACGGCAAATGTGTCAGGCCGAATTGTCCATTTTTG
GAGAGCGAGCATCCAGACGGCGCTTATACGGGACCACCACCGACGAGGTT
GTGGCGCTAGTGCTGGTGCGCACTGGAGCGGTTTGGCGGTGGTGTCGGTT
GACGGCGGTGGTGGTGTGGTGTGATGGTGTTTTGAGGTGATGGCGGCGAG
A

Sequences in the Contig:

SY0AAA15YK23FM1 SY0AAA44YA12FM1 SY0AAB39YM13FM1
SY0AAC32YJ03RM1 SY0AAD35YC10FM1 SY0AAD5YD23FM1