Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4424
Length(NT) : 903
Best Gene Model Blast : Link to GSTUMT00012252001 E-value : 9e-65
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4424
TTGGGTGGGTTGTGGAACGGGCGAGGTGAACCCTGGTATGATAAAATGGG
CTTGTCCGAAGATTCGTGTGGTGAGGAAAGCCCTCACCGAATGGTATTCG
TATTTTCTATGTTGTGACCTAATACCTCCTAGGTGGTCTTGTCTTTCAAG
TGGAGTGGATCTAAGGTTCTTGACACAGTGAATCACTCGGTGCTGTGGTG
GAGTGAAGTGGGGTTCCCCGGGTTTCTAACCCTAGATAATACTACTCGAG
TATGATACTTGATTCCTAACGGTAAGTGTGAATGAAGTTGTTGGTATGAT
ATGATATTATCATAACTATCACACTTCCGAGCTATCATGATAATTGGTCC
CTTTACCCCTCCTCTACTACCCACATCTCGCAGGCGTTCATTCAGCGAAT
CCCGTTTCTACGGCTACCCTCCTTAACAAAGTGTCAATCTCAGTCCCCTC
AGATCATCCAACAATAAAACAAGTTCCATCCCAACCATCCACTTCGAGAA
AGAAAGAAAAAACCCAACTAAACCGACGACCCGCCTGAGCACACCTAACG
AATCTGCACACTCCCTCAACACCTCCACCTGACCTCGAAGCCCAACCTCA
ATTCTCTCAAGCTCCGTGGAGATTTCCCCAATCTCCTGCGACATCCGCCC
GCACTTTGCGACGGTCTCTCTCCAAGGCGTGGGCGGGGCGCTATTAGGTT
TCGGTTATTAGCGAGTGGGATTGGGCTTTTTTTCAGAATGGGCGGGGGGG
TTACAGTCACTGTCACCATTTGGTTTGTCTTGCGTGTTTGTTCTTGTCTC
GAAGCTGTTCGAGCCGGAGGAATATAGACGAATGCCTGGCGTTCCGGACC
ACTGTTGAAGGTGATCATGGTTTGGAGGTGAAGAGTTATTTCCCGCGGTT
TTG

Sequences in the Contig:

SY0AAC32YI18FM1 SY0AAD25YG11FM1