Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4423
Length(NT) : 1076
Best Gene Model Blast : Link to GSTUMT00009366001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein AN5122.2
Accession: ref|XP_662726.1| Score: 997 E_value: 1e-106
KEGG Definition: hypothetical protein [EC:2.7.4.3]; K00939 adenylate kinase
Accession: ani:AN5122.2 Score: 997 E_value: 1e-106
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3078 Score: 662 E_value: 5e-70
PFAM Definition: ADK, Adenylate kinase..
Pfam Number: pfam00406 Score: 737 E_value: 1e-78
Swissprot: Q9HE76|KAD_NEUCR

Sequence:
>Contig4423
TTGGCGTCCTTCCGGGGCCCGTCCCTTTCTATCAATTGCGCTTCTGGTTT
CGACTCCACTCATACACGCTACACTCTCCACTCTCCACTCTCCACTCAAC
TCCACTCAAAAAATCAAAAAATTCCAAATATGGCACCCTCATTAGAAGAT
GTTGCAAGTCTCAAGGACTTGGTCAAAAAGCTGCAGGAACGGATAGAAAA
ACTCGAACTAAGCATCACTGGGGATCCCGGCAGCGGGGCGGATGCTCCAG
TCGATTCACTTAGGATGATTCTTATGGGGCCTCCCGGTGCTGGCAAGGGC
ACACAGGCTCCAAAGATCAAAGAGAAATTTTGTATCTGCCACCTGGCTAC
TGGCGACATGCTTCGCTCCCAGGTCGCGAAAAAGACAGCTCTCGGTCGTG
CGGCAAAGAAGATCATGGATGAGGGTGGTTTGGTCAGTGATGAGATCATG
GTTGGTATGATCAAGAACGAACTTGACAACAATACTGAATGCAAGAATGG
TTTCATTCTTGATGGCTTCCCTCGCACTGTTCCTCAAGCAGATCGTCTGG
ATTCTATGCTTGCCAACCGTGGCGAGAAGCTGGATCATGTGGTCCAGCTC
GAGATTGACGATGCCCTCCTGGTTGCTCGCATCACTGGACGTCTTGTTCA
CCCCGCTTCTGGGCGCTCCTATCATAGAATCTTCAATCCTCCGAACGAGT
CTATGAAGGACGATATCACTGGCGAGCCCTTAATTCAACGGTCTGACGAC
AACGCCGAAACTCTCAAGAAGCGTCTTGTCACCTATCACCAACAGACTAA
GCCTGTCGTCGAATACTACAAGGGGAAGAACATATGGAAGGGTATCGACG
CTTCGCAGGAGCCCGGTGTTGTCTGGAGACAACTCTTAGGCATCTTTGGA
GAGAAGAAACAGTTTCCGGTTTCTACTGCTGGAAGCAAAATTCTCGAGAA
GGTTGGAATTTCAAAATAGATTCTAGGATAGCGTTGCTTGTTTCTTTGAC
TTTATTACATGGGATGTGTTTTTCTGCGTATTGCCTACTTTCTGTGGGGG
GCTTTTTTTTTTTTTTTTTTTTTTGT

Sequences in the Contig:

SY0AAB7YF08FM1 SY0AAC23YL04FM1 SY0AAC32YI17FM1