Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4422
Length(NT) : 697
Best Gene Model Blast : Link to GSTUMT00001013001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: Glutamine synthetase (Glutamate--ammonia ligase) (GS) gb|AAP23163.1|AF462037_1 glutamine synthetase
Accession: sp|Q86ZU6|GLNA_TUBBO Score: 1067 E_value: 1e-114
KEGG Definition: hypothetical protein
Accession: ang:An01g08800 Score: 854 E_value: 3e-90
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0683 Score: 759 E_value: 1e-81
PFAM Definition: Gln-synt_C, Glutamine synthetase, catalytic domain..
Pfam Number: pfam00120 Score: 244 E_value: 8e-22
Swissprot: Q86ZU6|GLNA_TUBBO

Sequence:
>Contig4422
TTGGGCCAAACCGTCAATCACCATGACCGAAACATCTACCATCGTCTCCA
ATACGGCGAATGTAATGTTCCCATCACTAACATCCGGAACACACACACAA
GCTAACTGACTTCAACAATAGCTCGTCAAATTCCTCAACTTGGATCAGAG
AGGGTCAATTCAGGCAGAGTATATCTGGATTGACGGAGCCAACGGCGTTA
GATCAAAGACGAAGACTCTCTTCAAGAAGCCATCTTCTGTCGAAGATTTG
CCCGAATGGAACTTTGACGGATCCTCTACTGGTCAAGCTCCTGGTGAAGA
CTCGGACATCTACCTCAGGCCTGTCGCAATCTTCCCTGATCCTTTCAGGC
AGGGTGACAACATTCTCGTGTTGGCTGAGTGTTGGAATGCGGATGGGGCC
CCTAATAAGTTTAACCATCGCCACGAGTGTTCCAAGATTATGGAGGCTCA
TAAGGATCAGAAGCCTTGGTTTGGATTGGAGCAAGAATATACTCTCTTTG
ATCTTTATGGAAACCCATACGGGTGGCCAAAGGGAGGCTTCCCGGGCCCT
CAGGGACCATACTACTGTGGTGTTGGAACTGGCAAGGTTTATTGTCGTGA
CATCGTTGAGGCTCACTATAAGGCCTGTTTGTATGCTGGTGTTAAGATCT
CTGGAATCAACGCCGAGGTTCTTCCGTCCCAGTGGGAATTCCAGGTC

Sequences in the Contig:

SY0AAA49YO05FM1 SY0AAB58YL07FM1 SY0AAC32YI01FM1
SY0AAC45YE15FM1 SY0AAD4YI08FM1