Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4420
Length(NT) : 760
Best Gene Model Blast : Link to GSTUMT00006249001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_05308
Accession: ref|XP_001556539.1| Score: 392 E_value: 3e-36
KEGG Definition: hypothetical protein
Accession: ang:An04g03330 Score: 352 E_value: 6e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3351 Score: 312 E_value: 1e-29
PFAM Definition: No Hit Found
Swissprot: P53332|YG5T_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4420
TTGGCTGCAGTCGAGCACTTAATAGTGGCTGGTATGCCGTCTACAAGCAC
CACCTCCTTACATCCATTTGCTGACCCGTATAAAGTTGGCGGAACATTCG
ACCACCTCCACCCCGGCCACAAGCTCCTCCTAACAATGACCGCCTTCCTC
CTATCACCGAACGCTGCAGCGCCCCGTCTCGTGGCGGGCATAACTGGCGA
AACCCTCCTCATTAACAAGAAGCACAGCGCACACCTGGGCTCCTGGGACA
GTCGCGCAGCTGAAGTCGTAGACTTCCTCCGCGGTATCACTGACTTTTCC
GCGAACCCATCCCAACTCCTAACCTCGCCTTCATCGTCAACGCCGGAGAC
GGACATCACGCCTCGCTCAATCACTGCCACTATCCCCGGTGGCGAGAAGG
AGCTTGTCATCGAGACTGTAGAGATCAATGATCCCTTTGGGCCCACGATC
ACTAACGAGGCTATCTCTGCGCTCGTCGTATCCGAAGAGACGAAGAATGG
TGGCGAAGCGGTCAATAAGAAGCGTACGGAGAAGAGTTGGGATGCGCTGC
AGGTGTATAAGGTGGATGTTATCGATAATGAAGGGGGGGTCAAGATGAGT
AGTACGGATATTAGGAGAAAGTTGGAGGAGAGGAGTACTGCTTGAGTGGG
ATACCTTGATACCACTGTTTGTTAATGGATTTTGAAATCATAAGGATGTT
GGATGAGTGGACGGATGGATGGATGCAAGGGTTCTTTTTCCCTTTTTTGT
GGTTTATATT

Sequences in the Contig:

SY0AAC25YC01FM1 SY0AAC28YK20FM1 SY0AAC32YH07FM1
SY0AAD15YC10FM1 SY0AAD41YP17FM1