Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4419
Length(NT) : 1402
Best Gene Model Blast : Link to GSTUMT00003928001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4419
TTGGCCCAGGACCTTTCCCCATCCCATTCCGCCAAAATCTATCGACCCAT
CGACCCATCCACCTCTCTGGGGCCTCTCTTCCGAATTCTTCCTCTCTCAC
TCACTCGCCTTTACCTCTTTCCTCCTTTTTCTTTGCTTCCGAGATCGCTT
CCGCTCGTGCTTCCGGCGCAACGCTTGCGCCCAGCAAAACGATCATTTAC
CCTACATCGCTTTTGTCTCTCGTCTTGACCGCTTCCTTCCCTTTCCGAGA
CCCCTGCCTGCCTATCGTACCTTCCCGCCTCAACCAACACCACAAAACCC
GAGAAGAAACAGGAAGAAACATTCCATCCCCCCACCGAAACACGAAGACA
AAATATATTAATAGTTATGGGCATGCCAGTGTGGAAAGAACCTGTTGAGA
AAAGAGATATCGATGCCGTACTTGATCCTCGCCGTGCGGCCGTGCCTCGC
CGTTCGGCGCCCGGTCGTCGAATCAGGTCTTCCCAAACCCTGATGAATCT
ATTGCGGGACGATTTGGCGCGAGAGACGAACACCCTTTCTAGCATCGCAG
AGGGTAGACGTGAGCGCCCTTACCCTTGGAGCGAATTGAATGCGCTCCCG
GGCCCCGTGCCTGACCCAGAGCGCGCTGGATTGCGCTTGACACTGGCCGA
TGCGGAGGCTAGAGCACCATCTAGTGCAACCTCAGGCAGAGGGGGTATAA
GAAGAGTTCGCTCGCCTCTGCCGGTATTCAGAAGTGAAAACTATCGGTTG
CCTTCCTCTGCCTCCGATACTTACACCCCGCGCTTCCCCCCAACATTCCC
GGAGAGGCAGCAGGAAGAGGAGCTACGCCGAATTCGCACCCCTTTTCCCC
TTCCCACTGCTGCCTCCTCCTCCTCCGAGGGCAGCAGTAGCAGCAGCACG
GCTCCGCGCCGCGCTGGCGCTGAGGAAGGTTCTCAACGCCGATCCCAGTA
CTTTTCCCGTGACGAATCCTCTATCGATGAAACGGAGGGTGGAAGGCGTG
ATGAATTCTCCTACCTTACGGGCCCTTCCGCCAGGCGCTGGTTGGGGATT
GATGGGTTAGGGGACAGAGAGCGCAGTTTAAGTCCTGACCCTACTCACTG
GGAGTTGGTCGCTAATGGCTTGGGATTTCAAGCGGCGTGCGACTTGTGGG
AATCTGATTCGGATGCCGATGGGAACCCTCTCGCCGTTGAGGTGATGTGG
GATCTTCCACCGGATCGCGAAGAGGCCTTTAGAATTCGCCGTCTACTCTC
ATCCCGTAATGGGGGCATCGACCGCTTGATCGAGCGTCTTTAAATGCGTG
CTCGGTCGATCAATCCATCAGAAGGAAAAAAAGGAAAAAAAGGAATTCAA
AAACAAGGCTCTCCCTTCTTTAGTTTCTCTTCTCTTGTTCCTTATTATAC
TC

Sequences in the Contig:

SY0AAA8YH11FM1 SY0AAB19YM23FM1 SY0AAB4YF14FM1
SY0AAB58YG02FM1 SY0AAC32YH06FM1 SY0AAC34YI17FM1
SY0AAC36YC10FM1 SY0AAC58YK24FM1