Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4418
Length(NT) : 1215
Best Gene Model Blast : Link to GSTUMT00003856001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_03790
Accession: ref|XP_001595701.1| Score: 1380 E_value: 1e-150
KEGG Definition: hypothetical protein
Accession: ang:An02g10450 Score: 1364 E_value: 1e-149
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, General function prediction only].
Kog Number: KOG0446 Score: 997 E_value: 1e-109
PFAM Definition: Dynamin_N, Dynamin family..
Pfam Number: pfam00350 Score: 469 E_value: 1e-47
Swissprot: Q9URZ5|VPS1_SCHPO
Gene Ontology:
GO:0005794 = Cellular component: Golgi apparatus

Sequence:
>Contig4418
TTGGCATCATCCTACGTACGCAAAACCCTATCAATCTTTTCCGCTTCTCC
AACGAGCCGACCCCCTCCACCGGTCTGCACCCATCGCATATTCACATCCA
CTCCGCCGACCCTTCAAGGAGCCATCCTTTTGCCTCTTAATCCGACCCGT
TATGGCTCAACAAGCCAGCGTAAACGTTAACGACCCTGGGCTGATTACGC
TTGTGAATAAGCTACAGGATGTGTTTGCGACAGTAGGAGTACAAAACCCC
ATCGATCTGCCTCAAATCGTTGTGGTTGGATCTCAGTCTAGCGGAAAAAG
CTCTGTGCTGGAGAACATCGTCGGCAGAGACTTTCTCCCCCGAGGTACTG
GTATTGTTACAAGACGACCTCTTGTTCTACAACTTGTCAATCGCCCCGCG
CTGGCTAAAGCAAATGGAGCCCCGAAAGAGGAAGCTGTGATGAAGTCCAG
CGATTCCGCCGCTAATATGGACGAGTGGGGCGAATTCCTTCACATCCCCG
GCCAGAAGTTTTATGATTTCAACAAAATACGAGAAGAAATCGTGAAAGAG
ACCGACGCAAAGACGGGCCGGAACCAAGGGATATCTCCTCTGCCTATCGG
CCTCAGGATCTATTCACCCAACGTTTTAACCTTGACTTTGGTGGATCTTC
CAGGTATGACAAGAGTTCCAGTTGGAGACCAACCAAAGGATATCGAGAGA
CAGATTAAGGACATGATTCTCAAGCAAATCTCAAAGGCAAACTCTATCAT
TCTGGCAGTTACAGCGGCCAATACCGATTTGGCCAACTCTGACGGTCTGA
AGATGGCAAGAGAGGTTGATCCAGAGGGTCAGCGAACAATTGGTGTTTTG
ACGAAAATTGACTTGATGGACCAGGGAACCGATGTTGTTGATATCCTTGC
TGGTAGAATTATTCCTCTGCGGCTGGGTTACGTACCCGTCGTCAATCGTG
GTCAGCGTGACATTGAGTCCAAAAAGGCAATCTCGGCAGCGCTCGAGCAT
GAGAAGCGGTTCTTTGAAGAGCACCGTGCTTATAGAAATAAGCATGCCTA
CTGCGGAACGCCCTATCTTGCAAGGAAATTGAATATGATCTTGATGATGC
ACATCAAACAAACCTTGCCAGAAATTAAAGCTCGTATCTCCTCGTCTCTT
CAGAAGTACAGCGCTGAGCTTTCCTCGCTTGGCGACTCTTTACTCGGGAA
CAGTGCCAATATCGT

Sequences in the Contig:

SY0AAA34YC11FM1 SY0AAA50YD24FM1 SY0AAB32YI22FM1
SY0AAB44YD04FM1 SY0AAB55YL22FM1 SY0AAB61YF06FM1
SY0AAC32YG13FM1 SY0AAC51YC12FM1 SY0AAD40YB09FM1