Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4417
Length(NT) : 540
Best Gene Model Blast : Link to GSTUMT00008967001 E-value : 2e-80
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4417
TCTGACCTGGAGCACCAGGGTTATAGGTGCACTCAAATGAGTTGCTCTTT
AGTAAGGGTAATTGTTTACTAGGTGAAACACGCTACGGTACACCCCTCAC
TAGCTTCTCGAATCCTAATGATCCCAAAACCAAGGAAATCATTATTACGG
TAGTCGTTAGAAGAAAAAAAAAGAAAAAAAAATCTATATCAGCCACCAGC
TCATTTACGATTCAAGCCCCCCAAACTAAAATAGTCCGAAAGTAGTTTAT
GATAACCAACATACCAAAAGGTAAGAGGTAGAAAATGGAAACACTAGGGA
AAGCTAAATAGAAAGACAGAGAAGAAAAGGAAGAAAAAGGCACTTGGGCC
ACTATTGTACTTCAGTCCCAGCTGCGCACGCACCCGATATCTAGTATCTG
TACCCGCCTTGCATGTTGTTGTTGGAGATGGCCTTCTCGTCAAAGGGTCT
TGGACTTGCGGAGCGCATCGCTGAGCCATCCCAGGGACTAGGCGATCGAT
AACTAGAGCCCGTGACTTGGGGAGATATGCCACCGCTTCC

Sequences in the Contig:

SY0AAA23YM15RM1 SY0AAC32YG05RM1 SY0AAC33YO05FM1