Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4416
Length(NT) : 3304
Best Gene Model Blast : Link to GSTUMT00003845001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543379.1| Score: 3297 E_value: 0.0
KEGG Definition: histone acetyltransferase SAGA, TRRAP/TRA1 component, PI-3 kinase superfamily; K08874 transformation/transcription domain-associated protein
Accession: aor:AO090102000372 Score: 3235 E_value: 0.0
KOG Definition:
Classification: [Signal transduction mechanisms, Chromatin structure and dynamics, Replication, recombination and repair, Cell cycle control, cell division, chromosome partiti
Kog Number: KOG0889 Score: 2756 E_value: 0.0
PFAM Definition: FAT, FAT domain. The FAT domain is named after FRAP, ATM and TRRAP..
Pfam Number: pfam02259 Score: 560 E_value: 1e-57
Swissprot: Q9HFE8|TRA1_SCHPO
Gene Ontology:
GO:0005515 = Molecular function: protein binding
GO:0048017 = Biological process: inositol lipid-mediated signaling

Sequence:
>Contig4416
TTGGGCCGGGAGAATTTTCCAGGTTATGTGACGAAGCCATCCAATTATCC
CTTCGCAAGTGGCATAACCTACCGCGGAGGATCACTAACGCACATATTCC
CCTCCTTCAAGCGTTCCAGCAACTTGTTGAGTTACACGATGCGAGCGTTA
TCTACAGTAGCCTTTCTACAACAACTGCGCAGAACCTCGACGCTAAGTCA
CAAGAGCTTAAGATGCTATTGGGTACTTGGAGAGATCGGTTACCAAATGT
TTGGGATGATATAAATAGCTGGCGCGATCTCGTTACCTGGAGGCAACACA
TATTCCATTCAATTAACAACACTTACCTGCCACTTCTTCCAGGTCAAACC
CAAAGCGCAGGTGGCAGCAGCAACAGTTCTTACGCCTATCGCGGATACCA
TGAGACTGCTTGGATTATCAATCGCTTTGCCCATGTTGCTCGGAAACATC
AACTCCCGGAGGTGTGTATCAATCAATTGAGTAAAATCTACACCCTACCA
AACATCGAGATACAAGAGGCCTTCCTCAAACTCCGGGAGCAGGCTAAGTG
TCACTACCAGAACCCCAACGAACTCACACAGGGACTTGAGGTGATCAATA
ATACGAATCTAGGATATTTCGGAGCTGGTCAAAAGGCCGAGTTCTACACC
CTAAAAGGAATGTTTTTGTCAAAGCTCAAGCAGAAAGAAGACGCCAACGA
GGCATTTGGTCTCGCGCTTTACCACGACCTCAAGCTACCAAAAGCCTGGG
CAGAATGGGGCTACTATAATGACTCGCTATTCAGGGAGAATCCCCAAGAT
ATGCAACCCGCGGGAAATGCTGTTAGCTGCTATTTAGAAGCGGCTGGTCT
TTACAAGAGTGGGAAAGCAAGGAAGTTGCTGGGACGAGTCCTTTGGTTAT
TGAGTTTAGATGATGCTAGTGCCTCGATCTCTGGGGCGTTTGATGCTTAC
AAGGGCGACATTCCGATTTGGTACTGGATCACCTACATCCCGCAGCTTTT
AACCTCGCTCTCCCATAAGGAAGCTCGCCTTGCACGAACAGTTCTAATTA
AGATCGCCAAACACTTTCCTCAGGCCTTATACTTCTTGCTGCGCACAAGC
CGTGAGGATTACCAAGTTATTAAGAAGCAGACCGCCCAGGCAGCAGCATC
AAATCGTGGAAAGGCTGGTTCCCCAATCGTTGGCCAAGCAATTCTTTCAG
GTCGCCAGACTAGTGTTACGATACAAACACAAGCCAATGGAATTGAAACA
GTAATGGCGTCTAGCCCTCAGTCTGCCATAAGTTCTGGCCCCCAAGTTAT
CAAGGCCGGATCTCCGGCACCGGTTCCAACAGGGCAGAATATGTCATCAC
CCACCCCCGCTGTGCCCAGTCCCCAGCCACCGGTCAAGCGTTTACCTTGG
GAATACGCAGAGGAGATTATGTCTGTTCTTAAGACTGCGTTCCCCCTCCT
TGCTCTTTCAATGGAGACTATGGGCGATCAAATACAAAAATTCTTCAAGT
GCCCACCGGATGAAGACGCATATAGACTGATTGTTGCACTTTTGAATGAC
GGACTGCAGTGGATTGCGAGGATGAACCCTTCACTTGAGGACTCGAAGCT
CCCACCCTCTACTGAATCCAACATCACTCGCTTCGCGGAGACTATTCTCC
CTGCTCATATCCGGGTCGCGTTTGAGGCAGACTTTGTAAACGAACGCCTC
AATTTGTTCTCGTATATTGAGAGGCTTCGGCGCTGGAGGGATAGATTTGA
GGAGAAGCTTGATCGTCGACCGCCCAATCAGAACCTTGAAGCATATAGCC
CTCACTTGAGCGAGTTTAGGTTTCAGAGGTTCGACGATGTTGAGGTTCCT
GGCCAATACCTTCTGCACAAGGATAACAACAAGGACTTCGTTCGTATTGA
TCGCTTCCTCCCCCGAGTAGATGTTGTCCGCGGGTATGGTGTGTGCCACC
GACGCCTAAAATTGAGGGGACATGATGGAAGCGTACATACTTTTGCAATC
CAACACCCTGCTGCAAGGCACTGTCGCAGAGAGGAGAGGATATTGCAACT
GTTCCGTATTTTCAATGGTGCACTTGCTAGGAGAAAGGAAAGCCGTCGCC
GAAATCTCGGCTTCCATTTGCCACTGATGGTCCCCTTGGCACCGCATATT
AGAATCGTTCAGGATGATGCCTCCTACATATCCTTGCAGGGCATTTATGA
AGACCATTGCCGGAGGACAGGAATGAGCAAGGATGATCCCTTAATCTTCT
CGCTCAAGAAGGTTATTGCCTCGCTGGATCCCGGCAGAGGCGGGCAGCAG
CAGGTTGACGCAAACATCAAGTTGGAAATATTTAATTCTATTCAGTCAAC
CATGGTTCCCCCTAACATTGCGCTTGAGTTCATGACCAAATCGTATGCCT
CATTCACGGAATTCTTCCTCTTCCGTCGTCAATTCAGCTATCAGTATGCG
GCTTTGACTTTCATGACTTATGTTATGAATATGGGCAGTCGGTTCCCGCA
CAAAATGTTTATTGCCAGAGAGACTGGAAATATTTGGGGGTCCGAATTGA
TCCCTGCTATGGCATCAACTAACGCATACTTCCACAACAACGAATCGGTC
CCATTCCGCTTTAGTCCGAATATTCAAACACTAATGGGCCCGATTGCTAT
TGAAGGGATATTTTCTTGTGCCGTCATGGCCATTGCACGCTGTCTTACGG
AACCTGAGTTTGAACTCGAACAACATCTGAGTGTGTTTGTGCGCGATGAG
ATGATTTTCTGGTTCACTCAACAGCATCGTTCTAGTATAGGGGAACAGCA
ACTGCGAGAACGGGTACAAGCTAACTCAGAAATTATCGTTCGTAGAGCGA
CATCATTAGCACAGTCAAGCGGTGCTGGCGGTATCCCGGCCAACCAAACT
GTTATCGATTTCATTTCGAAGGCATCAAACCCAATGAACTTGGCACAACT
TGACAACCTTTGGATGCCATATTTGTGATTACGTGAGGATGATCGGTTTC
CTTTTTCTACAGGATCTGGGGTTGGTGGGGTTTGGGATTCGGTATCATGG
CTTTAATATTTGTATCACGACGGTGTTTCTTTGGCGCAGTTCCGGACTCT
TATAAGGGCAAAAAACTTGGTGTGGCTGCCTGATTTGCGTGTTTGTTTTT
ATTATTTTTATTTGCTGTGGATGTTAACTTTTGTCTTACATGCGTTTGAC
CTTGTCCTTGTGTATTATTAAACTTCCGTTATTCGCTGTCACAGATAGCT
TAATTCAAGAGTGTGCTACATGAGCGCTACACGGTTGAATGGAAAATATG
CTCT

Sequences in the Contig:

SY0AAA13YC20FM1 SY0AAA14YP11FM1 SY0AAA26YL05FM1
SY0AAA30YH13FM1 SY0AAA39YI20FM1 SY0AAA44YP22FM1
SY0AAA47YE13FM1 SY0AAB14YD17FM1 SY0AAB32YO03FM1
SY0AAB33YO03FM1 SY0AAB34YI19FM1 SY0AAB56YF11FM1
SY0AAC32YF06FM1 SY0AAC32YF06RM1 SY0AAC34YA17FM1
SY0AAC46YP03FM1 SY0AAD13YE17FM1 SY0AAD16YJ07FM1
SY0AAD1YJ05FM1 SY0AAD20YP08FM1 SY0AAD44YG08FM1