Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4415
Length(NT) : 1925
Best Gene Model Blast : Link to GSTUMT00009598001 E-value : 2e-89
Numbers of ESTs : 36

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4415
TTGGGAATGTGCGCTGGTATCTCTTTCCATTGACGGGTTGAAAAGGGCTG
ACGCATATTTCATTATCAAATCATATCATACCGGTATTCGCCTTTTCACG
AACGAAGGAGCGGACGGAGAACGGAGGTTCCGGGCAATATTAGTATTGGG
TGGATATAAAAGGGCTGCATTGGACAGTACCCCACGCGAGTCCTTTGCTT
GACCTGATGAACAGAGCGAGCGAAGGAAATAAACTTTCTGCTATCATACC
TTTTCACATCCCGAGATCAATTCTATAGTCCACAGGGGTGAGACATTCCA
GAGGAAACGAGGAATCGAAGGGGTATAATCCGAGCTTTGCTTTCGCCTCC
ACCCGCCTATGCTGCCGTACTGGGCTACAATATTTCATACTACCTAAGTG
CCTCGCACTCCCACACATCATCCATCGTCCAAGCATCACTCACTTCAACT
CATCCTTATTGCACCGCAACTCGCTTTCTCTCCCACTCTGGCCTTACCTT
ACCTACCCACCAATCAGCAAACGAACGACAATGTCGCCTATAATCTCCAA
CTACCTCCGCAAAAACCTCCTCTTAACCCTTCTATTACTCGTATTCCTGG
CGCTCCTGACGTCTTCCGAAGTTCTTGCGTCTTCCTCCTCCTCCTCCTCA
TCGTCATCACAAGGAGAGAGACTGGAGAAGAGAATGACCTCCTCCGCAGC
GTCAATTCGCTTCCCACAAGTACTCAATGAACCCCGAGAGCGCGGTCTTA
CACCTGGCTTCGTAGCCGTGGTGGTCGGTGGACTAAGTGTGGTTTTTGCG
GGGTTGATGGTTTAGACGCTGCTATCCTGCCCTCCTGCCCTGCCCATCAA
TGCCAGTGCTGTGGGCGGGCAACGCACACATGCCGGAACTAATTTCGGTT
TTCCCCCTGCCCCTCCTCTCACTCACTTGAGTTATCTTTCCTTGTTCAAA
CTTTGGGAAATGGTGTTTTTTTTTCTTTTTCTTGTGACATTCTGTATGAT
TTGGTTGTTGGGTGGTGGAATGATTGATTCAGGGGAAGGGGGGAAGGAAG
GCGTTGGATGGCTTGTCTTGATTATGATTATGGGTTTGATAATGATTTTG
GTGTTAGAATTGGGGTGTTGAGTGCGCTGACTAGGGAGGAGTAAGGAGAG
GAGAGAGGGAGGAATCTGGAGTATCTGGAGTGAATGGAGGGGAAAATTAG
AAGGGGCGGGCTCCATCGGCGACATCACCGACAGCACAGGGCCGGATGAT
TTCTCACCACCAAGTTCACTCGGACTCGACCCTCAGGGTGACCAACTCCC
TCACTCTAGACAATTGCTTCCAGCGTTGTACAATACGGCAGATATGTCTA
TACATCGCATCCCGTAGCATATCTAGACCGAAAAACAAACCACAACCACC
CATACAGGGCTCTATAAGCCCACCGACTGTAACAGTCTCTACCGGTGGAC
GAGTAGCTGTAGTATGCACACACATACCTCCAAACTAGCATGTCAATTAA
GGTTTGCTGTCATGACATTTACTCTATTATACCGTATATTGAGACTAGTT
GTGTTGACACCCACAATTAGTCTGTCCCTATCCTGTACTCGTACTTATTT
GTGGATCCCTTAGACCATATCAATCACGAGAGGAGGAACACCCCCAACAC
TTCGCTAGAGTAGACTTCTACAATACGCCAGAGTGCGTAGGAGATCCTGG
CACCCCTCCCCCCCTCATTTTGCACCAAAGGTATCCTACTTTACTGGTAT
GCCTGTGTACTCGGGTATCAGGCAGGCACTCTTGATACAAATAAAAATAT
ATCGATGATCAAACCAGGGCAGGAAAGCCAGAGGGATTTATTATATCTTC
GGACAGTCATTTCTCATTAAAAACAAATTGTCAAGAATGGTTGAGGGATA
CTTCCAATTTTGTGCGCACTACCGA

Sequences in the Contig:

SY0AAA13YF01FM1 SY0AAA49YG18FM1 SY0AAB30YD07FM1
SY0AAC15YH04FM1 SY0AAC17YB21RM1 SY0AAC1YM22FM1
SY0AAC21YN23FM1 SY0AAC26YE23FM1 SY0AAC27YE21FM1
SY0AAC28YD17FM1 SY0AAC31YD08FM1 SY0AAC31YM15FM1
SY0AAC32YF03FM1 SY0AAC32YF03RM1 SY0AAC43YN13FM1
SY0AAC43YO09FM1 SY0AAC52YK10FM1 SY0AAC58YN09FM1
SY0AAC5YK20FM1 SY0AAC5YP20FM1 SY0AAD10YM12FM1
SY0AAD11YM12FM1 SY0AAD11YO10FM1 SY0AAD18YI11FM1
SY0AAD1YI09FM1 SY0AAD23YK22FM1 SY0AAD2YL21FM1
SY0AAD2YP13FM1 SY0AAD36YG21FM1 SY0AAD38YJ05FM1
SY0AAD40YE19FM1 SY0AAD41YB15FM1 SY0AAD45YM08FM1
SY0AAD51YK03FM1 SY0AAD60YH17FM1 SY0AAD63YD24FM1