Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4414
Length(NT) : 1368
Best Gene Model Blast : Link to GSTUMT00010669001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_04434
Accession: ref|XP_001594627.1| Score: 1267 E_value: 1e-137
KEGG Definition: pre-mRNA splicing helicase, putative
Accession: afm:AFUA_8G04740 Score: 1213 E_value: 1e-131
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0951 Score: 221 E_value: 9e-19
PFAM Definition: Sec63, Sec63 Brl domain. This domain (also known as the Brl domain) is required for assembly of functional endoplasmic reticulum translocons..
Pfam Number: pfam02889 Score: 659 E_value: 2e-69
Swissprot: Q9UT24|BRR2_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005681 = Cellular component: spliceosome
GO:0000393 = Biological process: spliceosomal conformational changes to generate catalytic conformation

Sequence:
>Contig4414
TTGGCGAGTTATTACAGTCTAACAGATATCTCTCACGAAGGGCTTAGTAC
CCATCTCTCCGAGATGGTAGAAAACACCCTCAAGGATTTGGCCGAGGCCA
AGATTGTTGATGTTGATGAAGAAGACGACACCGTCACTCCCCTCAACGCC
GCCATGATTGCAGCATACTACAACATCTCCTTCATAACAATGCAGACATT
CCTGCTCTCACTCACGGGCAAAACAAAACTCAAGGGTATTCTGGAAATCG
TCACCTCAGCCACGGAATTCGAGTCTATCCAGATCCGCAGACACGAGGAC
CGGGTACTACGTCGCATCTACGACAGTGTCCCAGTCAAGATGTCACAGCC
AAACTACGAATCCCCGCACTTCAAAGCATTTGTACTTCTCCAAGCCCACT
TCTCCAGAATGCAGCTCCCTGCGGACCTAACAACCGATCAGGCTGTAGTG
TTGGGCAAGATCCTCAACCTCCTGAGCGCTTGTGTGGACGTTTTGTCTTC
AGAAGGCCACCTGAACGCTATGAGCGCTATGGAAATGAGCCAGATGTGCG
TCCAGGCAATGTGGGACCGCGACAGTGCGCTCATGCAAATCCCATTTTTC
ACACCAGAGCGTGTCAAGGCTGCTGGCGAACTCGGCATCAAAACAATCTT
CGATTTCATGGACGCCATGGGTGAGGACTCCACCCGCACCCGCCTCCTCC
AGCGAACCTCCATCACCGAATCCCAACTCGGCAAAATTGCCCACTTCACC
AACAAAAAATACCCCAATATCGACCTCGCCTACGAACTCGAAGACCCTGA
CTCTGTGGTCGCTGGTTCCCCCTCTTACATCAAAGTCAAAATCGAGCGCG
AACTCGACGGGGAAGACGAGAAAGCAGAGGTGGACACGACAGTGCATGCG
CCCTTCTACCCCCAAAACAAAATTGAGAATTGGTGGATTGTTGTTGGTGA
GGAGAGTAGCAAGGCTCTCTTGGCGATCAAGAGGGTTACGATTGGCAGGA
GGTTAGATGTCAGGTTGGACTATACCGTGCCAAATCCCGGCAGGCACGAA
CTCAAGTTGTTCTTAATGAGCGACAGTTATGTCGGAGTTGATCTTGAGGA
GGATTTTGAGGTTGAGGCTGCGGAGGGGATGGATGAGGATGGTGACGAGG
AGGACGATGATGAGTAGATCGTTGCTGTACTCGGCGACAGGGCTGATTGA
AAAAGAGGGGGGTGTGATTGGGAGGTTGTAATCTAGTCCCTTCCCGGTCT
TTCTTTTTTGCTGAATGAGGGATGGTGGGGGGTTCTATATCAAAATTGAA
TTCCACCACAATGTTTCCCTCGTCCATGTTCTTAATAGTTTTGTACGATA
CTATAGTGACAGATGTCG

Sequences in the Contig:

SY0AAA4YL05FM1 SY0AAB37YJ12FM1 SY0AAC32YF02FM1
SY0AAC46YJ16FM1