Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4413
Length(NT) : 1275
Best Gene Model Blast : Link to GSTUMT00004483001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_07812
Accession: ref|XP_001553725.1| Score: 232 E_value: 2e-17
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01376 Score: 210 E_value: 4e-15
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P27574|PYP1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004725 = Molecular function: protein tyrosine phosphatase activity
GO:0045930 = Biological process: negative regulation of mitotic cell cycle
GO:0032873 = Biological process: negative regulation of stress-activated MAPK cascade
GO:0045014 = Biological process: negative regulation of transcription by glucose
GO:0006470 = Biological process: protein amino acid dephosphorylation

Sequence:
>Contig4413
TTGGGGTTTATCACGCCCAGTGATCATGAGCTTTCGATACGCATTTGGAA
TTCTTTGACGCCTCTCTCCGACTGGTTCTCGATCTCGCTTGTCTGACGAC
CTTTCGTCATAGTCTGCTAGTTTCCCCTTAAAGCCTCCCCACCTCGCAAT
TTGGACCGGATTTCCATAACAGTAAAGTATAAACAACACAGCATTATTAC
TCAATAATACCTCTCAGCATGTCGGTAACGACCTCAAGACCGTCGCCACG
GTCGTCTCTCGATTTTCCAGTTCACAGCCCGCATTCCCAAGTACGCTCAC
AGCATCCTCTTCCTGCCATACAAACATCTTATACCTCAACGGCCGCGCCA
CCTCCGTCAGCTGCGCCTACTTCAGGAACAAAACAGGGTCCGAAGCAGGG
GAATCCTAACCCCCCAAGTCCCGCCGGCTATTTTGGGTTGGTTCTAGATC
CTGCCGAGGGTCAGCACGCTAAAAACAATTGGTCGTCTTCTGGATCTTCT
GTTCGTTCGACAGCTGCCAGGTCTCCGCGTCCGGTTCAATTCGACCACCT
ATCTACACCGTTCCAGATGCAATCAGAAGCAATCGTTCTTAGCCTTAAGC
ATCCGAACGGCCGCATTGCATCGGAGCCTGAGCATTTGTCGAGGGAAATC
ACCGAAGGGGAAAAGATTGGATTTCCACTGGGATCATATCCATCTCCAGA
ATTATTGCACCATATGCAGAGGGAACGTCTTGGAGCCATGATACCGGGAT
CAAGCTTTTTGAACGGTGCGAGAACCGCTTCTCTAACTGCGTTGGGCAGC
GTTCGAGAAACATGTTCCCGTTCGGATGATAACCCCCCTCGGCTTTCCTT
CCCCTCATCTCCATCGTCTCCAAATAAGGCGTCTCAGGATTCTATAGCAC
AAAGGATTAAGAGCCAAGCTCAGGGGCGATCTTCCACGTCACCGACCCCC
CCAAAGGAAGGGGACCCAGTCCTGTTATCTACGTCGCATCTGGTGGAACT
TTTGAACGCCAACACTTCGAACCTTCTATTACTCGATGTTCGAACCTATA
ATTTGTACGCCGAGTCTCGCATCGAGAGAGCTGTCAATCTATGTATTCCT
ACAACTCTTCTCAAAAGGCCCTCGTTCAATGTCACTAAGCTATCGGAAAC
GTTTGCAAAAGATGAGGATAAAGAAAAGTTTGCCACATGGAAGGATATGA
AATACATTGTGGTGTATGATACCGATCTCAAGGATCTCAAGGACCCGTCG
ACAATGACATCCTTGCATACTCTCA

Sequences in the Contig:

SY0AAA15YI22FM1 SY0AAA4YA22FM1 SY0AAC32YD14FM1
SY0AAC9YM23FM1