Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4412
Length(NT) : 1702
Best Gene Model Blast : Link to GSTUMT00000560001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein FG06161.1
Accession: ref|XP_386337.1| Score: 696 E_value: 5e-71
KEGG Definition: hypothetical protein
Accession: fgr:FG06161.1 Score: 696 E_value: 2e-71
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3045 Score: 603 E_value: 7e-63
PFAM Definition: Methyltransf_8, Hypothetical methyltransferase. This family consists of several uncharacterised eukaryotic proteins which are related to methyltransferases pfam01209..
Pfam Number: pfam05148 Score: 509 E_value: 5e-52
Swissprot: P38961|RRP8_YEAST
Gene Ontology:
GO:0005730 = Cellular component: nucleolus
GO:0008168 = Molecular function: methyltransferase activity
GO:0006364 = Biological process: rRNA processing
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig4412
TTGGCACCAGTCAATCCCGATTATTATTATTATTATTATCGCTCTAATTT
GTCCTCCGCCTCCACCTCCCCACCCATGTTTGCGGTCAGCGGATGGAATC
TCGAGGCTGGGCCAACGACTCAAGTCGATGAGTCGGTCAAAAAGAAGAAG
CGCAGATCAAAGTCCTCCAAGTCCGCATCGAGCAGCAATGCTACTCCAAT
TGCGAACAAGAGATTCCCAGCAAAGAAGCCCGAACTAGAAAAGGAGACCC
CCAAGTCTAAAGGGGAAAAGCAGATTGTGGTGACTTCGGAAAATGTTCTC
GTGTTATACGAGAAGATTATTGAGGGAAAGAAGCCAGCTAAGAAGCAGAG
GGATCGGAAGAAGAGCAGGAAACCAGCAAAGACAGATCCTTCGGAGGTAG
CAGCATTGACCGTGGCGAAGAAACGGAGCAAACCCCACGACGAGGAAGGC
GGCGAGGGATTGACTTCCAAGACTATCGAAGGTGCAAAGGAAGGGAACTC
GACACAAAATGATAGCCAGACCGTTCTCCTTAGAGAGAAGAAAGAGCCTC
GGGGAGTGATAAGGAACGCAAATACAGTATCTGCCACGGCTAATACCGAA
GCCCAGTCTGACTCGGCCGATAAAACTCCTGGATCGGCCCCCATCTCTAC
CTTAACTCCCCTCCAACAGAAGATGCGTCAGAAACTCTCTTCAGCCCGGT
TCCGGCACATCAATGAAATTCTCTATACCACATCGTCCAACTCCTCCCTC
AGCCTATTCCGCGAACAGCCCGAAATGTACCAAGAATACCACACGGGTTT
CAGGCGGCAAGTCGAGGTCTGGCCCGAGAATCCTGTTGACGTCTTCATCA
AGCAGCTACAGGAGCGAGGAAGGGTCAAATTTGAGCGGGGCCATAATAAA
AAATGGAACTCTAATGCTGGGAAGAACCTATCCCCCCTCCCAAGAGACAA
AGAGGAGGGGTGGTGTACGGTGGCTGATCTTGGATGCGGGGATGCCAGAA
TAGCAGCTACGATCAACCACCAGAAGCCCTGGGGTAAAGCCAAAGTCAAA
GTCCTTTCTTACGACCTCCAGGCTAGTAACCCAGACGTAACTGTCGCCGA
TATTTCACATCTACCCTTAGAGCCAGATTCGGTAGACGTGGCCATCTTCT
GCTTGGCACTTATGGGCACAAATTTCTTGGACTTTGTCGAGGAGGCATAT
CGGATCCTGAGATGGAGAGGTGAACTTTGGGTTGCCGAAATCAAGTCCAG
GTTCAACTGTCCTAGTGCAAATGAGGTAGAGGATGATGCGGAGATGGAGG
GAGGGCTGAAAAAAGGGGCCGAGCCCTACAAACCATTTGTGGATGCACTT
TCCAAGCGTGGCTTTGCTCTTAGGGGGACAGTAGATGATGGGAACAAGAT
GTTTGTGAGGATGGAATTTGTGAAAATGCAGGAAAAGGCAGAGAAGGACG
GTGGAGGCGGTGAGAGCTGGGAGCCCAGGGTGAAGAAGAAGAAGTTGAAG
TTTGTCGAGAAGGATGAGGTTCGAGAAGACCAAATTTTGAAGCCTTGCGT
ATATAAATTAAGATAGGATGGTCGCCATGAGAACCTAACGCTGGTTGCAT
TGCATTTGATCTCGGCTGTTAGGAAGCAAACATGTACAAATAATAGGAGC
CTATGATGCAAACCCCAATGGTGGGAAGTAAATTACGTGGCTATTAAACG
AG

Sequences in the Contig:

SY0AAA37YO23FM1 SY0AAB29YC02FM1 SY0AAC32YC21FM1
SY0AAC32YC21RM1 SY0AAD51YH20FM1