Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4410
Length(NT) : 522
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 13

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4410
TTGGCCACGAAGTCATATTTGCGGGGCTATTATGCGGTGTAAAAAGTGAT
GCGAGTATGATAATTAGTTTTATCAGAACTCATTATTCACTCTTTCTTTG
AGAATTGCCAAGACCACCCATTTCTCCTCATTGGCGCTAACGACCCAGAG
TTCGGTTGTGAGCAGAAGGTAAGGACGAAAGCTCCCCCTGAATTACCTAC
CGGAACAACATCACTTGTCTCCGTCCTATAAAAAAAATAAAAATAGCGGC
TATCTTAACTGAGTTTGAATTCATCTGAATTACAGCAGCAGCAGCAGCAG
CGGCGGTGGCGGCACCATATCGATACCGACGCTCGTATCACAGCAACGGA
ATTGCCCACGACGTTTTCTGCAGTATCATACTTTACCGTCGAACCCGTAT
CATCGTTGCTTTATCGCGGGGTTCCCGTCTGTCACTGTTTCTCGTCATTA
TCGCGAACCTCCCGCAGGCCCGTTCACCTCCTCACTCCCCCCCCCCCACA
GTCTCTTTTCACACACCCCCGC

Sequences in the Contig:

SY0AAA24YL22FM1 SY0AAA24YL22FM2 SY0AAC18YH15FM1
SY0AAC22YD23FM1 SY0AAC32YA14FM1 SY0AAC39YI01FM1
SY0AAC45YM02FM1 SY0AAC56YK12FM1 SY0AAD33YG07FM1
SY0AAD35YJ19FM1 SY0AAD42YC08FM1 SY0AAD45YB21FM1
SY0AAD9YF05FM1