Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig441
Length(NT) : 733
Best Gene Model Blast : Link to GSTUMT00007099001 E-value : 1e-118
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig441
TTGGGATTCATCTCTCGACAAACACCTCCTGCCGACCAACCATCAGCACA
ATTCCCATAGAAGGCATCAAAACGCAAGAGAACCCAATAAATACCTCTCA
AAAACCAACTCTGAGCCGCACACCGCATCCGTACGATTCCAACGCTTCTG
TTCTGGCCGAGGAACAAGCCTCGCCTGCCCATCCGTGCCGAAGCGAGAGA
GAACGCGCCGACAAGATGGAAGCTGCTGTCTTCAAAGCCCTTCAGGAAGC
CTTCAGCCCCAACAATGGCCTGGATTGGACATACGAAATACACGAACTAG
TCATCGTTGATTCATCTGGTCGAGAATCAACTATCCCAGCGAGGGTCGTT
GAATATCTGCTCCACGCTCGGCGCCTGGGTTTCGTGCGCAGACCGGTTAA
GAATCAGCGCCGCTCGAAGAGATTATGAAGAAAATGTCTCAGGGGCGCTC
AAATGCGTCCAGCTTCCGACGCCAAGTCCGGACAAGGCATGCAATCGCCC
CTCGTCAGGAGTGACCTACCTTAGCAGAGTCTAAAGAACCGGAAGAAAAA
GAAGAAGGAGAAGAAGAAGAAGGCGTGAGCCGGTAAAATCTGGAGAACCG
ACATGGTTGAGAGAGATTGGGTGAGGATGGAAGTTTGGGTTTGGTCCGGG
CCGGCCATGGCCTCGGCCACGGGCGGGGGGGACGGCGGAAAGTTCGGCCA
ACACACCCGAACCGAGTATTTCAGCATTATTTC

Sequences in the Contig:

SY0AAA24YC03FM1 SY0AAA24YC03FM2 SY0AAA37YB05FM1
SY0AAA42YN12FM1 SY0AAB49YP17FM1 SY0AAB53YH09FM1