Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4409
Length(NT) : 588
Best Gene Model Blast : Link to GSTUMT00006944001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57039.1| Score: 375 E_value: 1e-34
KEGG Definition: C2C2-type Zn-finger protein
Accession: aor:AO090001000530 Score: 375 E_value: 7e-35
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2990 Score: 302 E_value: 1e-28
PFAM Definition: DUF572, Family of unknown function (DUF572). Family of eukaryotic proteins with undetermined function..
Pfam Number: pfam04502 Score: 237 E_value: 4e-21
Swissprot: Q9D516|CC130_MOUSE

Sequence:
>Contig4409
TTGGGGGGACAACTTTGTACAAAAAAGTTGGCGAGCACAAACCAGACCTC
ACAAACTTCCACGCTCTAAAACAACCCGCGAAGCAAAAACAAAACACTTT
GCGACCAAACCGCAATCATGCAAGGTTTTAACATGGGGTGCTTTTTCCTT
CCCATCCTTCACCCTCACACAATGTGCTAACATCCATTCCCCAGACGCTA
CGTCCCCCCGGACCAAGAAGGCATCTACACCGGTAACCAGCTTCACAAAA
AAAAACCCCCGGGGATCCATGGCAGCACCCAAACCGTGCGTTTCGAAATG
CCCTTCGGCATCTTCTGCCTCACCTGCGACGGACACATAGCGCAGGGCGT
GCGCTTCAACGCCGAGAAGAAGAAAATCGGCAAGTATCACACCACGCCGA
TATTCAGCTTCCGCATGCGACATGTCAGCTGCAGCGGGTGGATCGAGGTG
CAGACCGATCCAAAGAATACGAGGTACGTTGTTACTGAGGGAGGCAAGAA
GAAGGGTGGAGATGAGGGGGAGGGGGATGCGGTGGTGGGAGAAATCCACA
TTCGAGATCCGAATATGCCCGGTGATCCATTCGCCGCG

Sequences in the Contig:

SY0AAC31YP22FM1 SY0AAC47YO11FM1