Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4408
Length(NT) : 871
Best Gene Model Blast : Link to GSTUMT00004078001 E-value : 2e-99
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0307 Score: 128 E_value: 3e-08
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 113 E_value: 2e-06

Sequence:
>Contig4408
CAGGAGGGTTTTAAAGAAAGGAAGACAAAATAACCCCCACAACAGGCAGG
TCGAAGAAGAAATGAATGATGGTTGATGTTGAAATCTTTCGTCATGTCTC
ATCGCCACCGTTGGTAATAGAAAAATGAACGAGATAAAGAAGTGAAAAGT
AATAATAATAAAAAAAGAAAGCGCATCGAGTATCAGGTTGTCTGTCACTC
CCAGCTCCCGCCATACCGCTCCTTTCCCCTCCATACGTCTTGAAAACCAG
TCTCAGTCATGTTGTCCTGCCCCTGTCCCTGCTGCTGCTGCTGCTCTTGC
TGTCCACTACCACTATCACCGCTAACCCCACCATCTAAGCCCCTCCGTGA
TGGCTACATGATAGTTGCATACTCCTGATACCTGTCCCAACCGAACCCCC
CGAATCCGCTGCCAGTGCTGCACTGTTGCGCCACAAGACTGGGCAGAGGA
AGTTGCGTCAGCGGGAGTTGATGCGATGGCGGCTGAGAAGAATACTGCTG
CTGCTGCTGCTGCTGCTGGTGGTGCTGAGCCGGTGAGTTCATGCTTGGCA
CCTCTGACATTCCCATAGCCCCCCAACTGGATTGGTATGGTGCTGTATTC
GTTGTTGGACTGTCTGTGTCAGGGCTCGATGGGAGCACCCTCCATGCCTC
GACGGGTGGTGGTGGTGGAAGGGATGGTGGTGGTGCAGGCGGTGTTGGAG
ACCACCAGCCGGCAGCTCCAGGCGAGCTCGGGAGCAGTGGTGGTGGGGCT
CGCACAACGTCGACAATTCGTGGTGGAGGCGGCAACAACGGTAGGAAGAA
ACCCAACACAAGGCCTCTAACCTCATCGCTCCGCCCGCAGAGCAACTCAC
CGGCCCCATCGTCCTCCCCAA

Sequences in the Contig:

SY0AAB12YG13FM1 SY0AAB45YI07FM1 SY0AAC31YP13FM1
SY0AAC34YC20FM1