Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4407
Length(NT) : 1705
Best Gene Model Blast : Link to GSTUMT00004448001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: cysteine desulfurase, mitochondrial precursor
Accession: ref|XP_001544101.1| Score: 1928 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An09g04280 Score: 1913 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1549 Score: 1352 E_value: 1e-150
PFAM Definition: Aminotran_5, Aminotransferase class-V. This domain is found in amino transferases, and other enzymes including cysteine desulphurase EC:4.4.1.-..
Pfam Number: pfam00266 Score: 850 E_value: 2e-91
Swissprot: P87185|NFS1_CANAL
Gene Ontology:
GO:0031071 = Molecular function: cysteine desulfurase activity

Sequence:
>Contig4407
TTGGCTCATCTGGAGCTCCGGATAGTCATACTCGTAGAACCAAACATCCT
CACCACCACCCACCTCTTCTACCTCTTACCAGACATTTACCTTTCCCCTG
TGCTATCTGATAGCCACACCACTGCGGGAGATTCCACAACTCTTGCGTTA
TGACGACAGCCGCCAAGGCCGTTCGATGCGTCGCGAGCTTCTCTCGTGCT
TCACTTAGGCCTGCTGCAACTGTGCAGAGGGGATTGACAGCACAGCTGCG
GCGCAGGTGCATATCTTCAAGCGGGAAGGATGGGGGGGCTGCTGTAAAAG
TGGACATTGAGAATCGACGAATGGATGCGAGTAATTTTATGAATGGGACT
GGACTCAAACCCGCGGAGGTTGGTCTGGCCGCGGATGCGATGATGTCCCC
TTCTGCCGGTATTCTCAAGCAAGCCACGATAATGGACGAGGGATCTCGAC
CAATCTACCTCGACATGCAAGCTACAACTCCTACGGACCCTCGCGTGCTC
GATGCTATGCTTCCCTTTTATACCGGTCTATACGGAAATCCCCATTCACG
CACACACGCCTACGGCTGGGAGACAGAGAAGGCGATTGATGTCGCGCGTG
AGCATGTCGCAAAGCTCATCGGAGCCAACCCGAAGGAGATCATATTCACC
TCTGGAGCCACCGAGTCAAACAATATGTCTATCAAGGGTGTGGCAAGGTT
TTACAAGTCTAAGAAGCATATCATCACATCACAGACGGAGCACAAGTGTG
TATTAGATTCTTGTAGACATTTGCAAGATGAGGGGTATGATATCACGTAT
CTCTCCGTCAAGAACAACGGTTTGATCGATCTGGAGCAGCTGGAGAAGGA
GATTCGCCCAGACACAGCGCTAGTCTCAATTATGACGGTCAATAATGAGA
TTGGGGTCATCCAGCCGATGGAGGAGATCGGAAAGCTGTGTCGAAGGAAG
GGTGTCTTCTTCCACACCGATGCCGCTCAGGCCGTGGGCAAGATTCCCGT
CGACGTCGGCAAGTGGAACGTCGACTTGATGAGCATCTCCGGCCACAAAG
TCTACGGACCGAAGGGTATCGGAGCCTGTTATATCCGCCGCAGACCAAAA
GTCAGGATCGACCCGCTCATCTCGGGCGGCGGTCAGGAGCGTGGTCTTCG
CAGCGGAACCCTCGCACCCCCATTGGTGATCGGGTTTGGAGAAGCCTGCA
GAATCGCCCAAGAGGAAATTGAGTACGACCACAAACGCGTAACCACCCTC
TCAAACCGCCTCCAATCCGGCCTCCTTGCGATGGAGCATACGACCCTAAA
CGGGGATCCAAACTCCCGCTACCCCGGCTGCGTCAACGTCTCCTTCGCAT
ACGTAGAAGGAGAATCCCTCCTAATGGCACTCAAGGACATTGCCCTATCC
TCCGGCTCAGCATGTACCTCTGCCTCCCTGGAGCCCAGTTACGTCCTCAG
AGCTCTTGGGTCTAGCGACGAGAGCGCGCACTCCAGCATCCGCTTTGGAA
TCGGCAGGTTTACCACTGAGGCTGAGATTGATTACGTGCTCAATGCCGTC
AGGGATCGGGTCACCGTTTTGAGAGAGATGAGTCCGTTGTGGGAGCTTGT
ACAAGAGGGTGTGGACTTGAATACCATTGAGTGGTCGCAGCATTAGAGAG
AATTCCTGCGAGGCTGCTGTTATTAAATAGGTTTTTGATTCACTCATTCC
CTCAC

Sequences in the Contig:

SY0AAA30YA20FM1 SY0AAA43YF23FM1 SY0AAA4YF08FM1
SY0AAA57YE02FM1 SY0AAB34YB11FM1 SY0AAB56YM11FM1
SY0AAB59YN17FM1 SY0AAC2YH06FM1 SY0AAC31YP10FM1
SY0AAC33YO09FM1 SY0AAC46YM20FM1 SY0AAC54YA10FM1
SY0AAD53YE10FM1