Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4406
Length(NT) : 1388
Best Gene Model Blast : Link to GSTUMT00004276001 E-value : 1e-100
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4406
TTGGCTTCCCGGATCTCCCCATCAGCTTTGCTTCCACATCCGGGAGGAAC
GCCTTTGGGGATTATCCTCACCTAAAGTCTGCGAGCGATCCGGAAACTGC
GCTATTGGGCTTACTCTTCTCGATTATATATTAGAGGCTAATATTCCTAT
GCCTCGGAGTACTGCGTAATCGTGCAAGTGGCCACCTGAGGACTCAGGTC
TATTTGCATACAAGAGTTAACAAAAGTGGGTTAGATGGTGAACTTTTCAT
GACACCGGGTATCTTATCAACCCTGCATCTATTTTCTTGCTTCTTATAAA
GTCGTCTCCGTTGTGGGGGGTATATTTCACACTTCGGTCACTTTCAGGGC
TCTTACTTTATCATTCAGTATTCTTGAGTATAGAAATGATGTTCGGTGAA
GGGTATTCTGCAGAAGATAAAGGTTCGTTGAAACTGGGGAGAGACGTTGA
AGCCAGACATGCCTCACTCAATCATGGAACTGCGATAGATTCCCGGCGCG
CCGAAGTAGATTTGCCTGAAGCAATCAAGTTCGGAAAGGCTACATGGGGC
CTTTCTAGCAGGCAACTCCAGGTTTGTTTCTTTTATCCTCTAAATAAAAT
GGAACATATATTAGCTGAATTGACCTTTAGCTTAAAGCAATTGGGGACTC
GACAGGCACCGGCCTATTCGTCGGAATTATATCCTAAGTAACCGCCCAAT
GATCAGATACTCTACAACCGCAGATCTAGTGGCTGCTAACTCGAGGTGAT
CAAAATGCTCCCGCTGAGGCTGGACCTTGGTTGGTGTTTCTTGCGTATTA
CTTCGCTCTCCTTCCGAGTATTGGGGGGGGGAGTCGAATTAGGAGCATAT
CGCTGCTCAGGCGTGTCCCTGGCCACCTGTCTACCGAGCCTCGAATTTCC
ACTCTATTGAAAAGTGGGCGAACGGTGCTCTCAGCCCTGATGCGGGATTA
CGTATTAGTGTGGGGCTAAGGCGTTTGTCTGTATTGACCTCGTTGCTTGG
TCTGATCTGAGTCCTGGCATCCAGATTACAGTTGCCCTTGGTCTTTCGAT
TCCACTAAATTGCTTTGCCGTGCGGTACTCCGATGCTGGAAGGATCCGCC
TAATGAGGGGATGCCTGGTTGAAAGGCACTACTGGAAGATTTCTAAGCAT
TTGGTCCTTTCTGATATACGCAGCGTTTGCCCGAGTTTTCATATTGAGCT
AGAATTGGGTGACCTATATCGGTATGAGGGCAGCAACATCAATACTTCCA
ATGAATGACATAGGCCCCGATATATTAATAATGATCTGGGGGAGTCCAGA
ATCCACGCAAAATTATCCCCATCGCAGTTAAAAAAGTCTATATTAGTCTC
TAAGTTACCATTTCTATGTCATGGGCATGCTATATGTA

Sequences in the Contig:

SY0AAC30YH10FM1 SY0AAC31YO11FM1 SY0AAC39YN15FM1
SY0AAC58YH19FM1