Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4405
Length(NT) : 704
Best Gene Model Blast : Link to GSTUMT00008760001 E-value : 1e-159
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU09122
Accession: ref|XP_958894.2| Score: 353 E_value: 7e-32
KEGG Definition: ubiquitin conjugating enzyme [EC:6.3.2.19]; K10688 ubiquitin-conjugating enzyme E2 W
Accession: mgr:MGG_09913 Score: 351 E_value: 6e-32
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0427 Score: 237 E_value: 6e-21
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 191 E_value: 1e-15
Swissprot: Q8VDW4|UBE2W_MOUSE

Sequence:
>Contig4405
GGGTGAAAAATGTTTTCACAAAGAGGTCTTCCATTTCAAAAAGGCTCAAA
AGAAGGAGAAAACGATAAGAGGTTTAAGTTAAGCAATTCCCTTTACATAT
ATGCCGAGTGATGGTTCATGATCAACAGTCCGAGGAGAAAAAAGCGGTGT
AAAGATAGCTAAGTTGTAGGTAAAAGTCAAGGAAAAAAGGGGAAAAAAAA
GGTATGCGCCCACTCGCCCGTTTTCTCTGCGATCCTAAACCATTTCCCTG
GTACGCTCCCTGTATCATGTACGATTCGCGGCCCATTGCTTAAAGTATTC
CGGAACGCCTTTGAGTACATGGTAGGTAGGTTTAGGGAGAGGGGGAAAGA
AAGGGGAAGAGAAAAGGAAGCAAAAAGAAGAAGAAAGAAGAAAAGCTAGA
CAGTATTGTCATCGTAGACGAAGCGGATGTTACGAAGGGAGGTGCTTGTG
CGGAGGACGAACTGGTCATCACCGTCGTTCTTCGTGTTCCCAGTAAGCAT
ACTCTGGATACTCATGCACACGCTCTCAACGCTCTGGACGGGGCTCCATC
CGTTTCCGCTGCTGAGGAGATCCAGACAGATTACGCCATTAGAGTAGATG
TGTGGGTGCATTGGGATGTCTCTGTCGGTAGCTCTAATAAACATGACCTC
GGGGGCCTCGATAGGGTAGTTATTACTGAATTTGAATTTGAGCCTGTAAG
CCAA

Sequences in the Contig:

SY0AAA32YB11RM1 SY0AAC31YO03RM1 SY0AAD30YI23FM1