Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4402
Length(NT) : 779
Best Gene Model Blast : Link to GSTUMT00001447001 E-value : 1e-122
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An02g07470
Accession: ref|XP_001399881.1| Score: 289 E_value: 5e-31
KEGG Definition: hypothetical protein
Accession: ang:An02g07470 Score: 289 E_value: 2e-31
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG4153 Score: 301 E_value: 2e-28
PFAM Definition: F_bP_aldolase, Fructose-bisphosphate aldolase class-II..
Pfam Number: pfam01116 Score: 138 E_value: 2e-09
Swissprot: Q9HGY9|ALF_ASPOR

Sequence:
>Contig4402
TTGGCTTAAATCAAACTTATCTCTTGTAAGTTTTTACTCTTCTCTCTCAC
TGCATTTCTTCCTCCCTCCCTCCCTTCCTTTCTTCCTTTCTCTTTTCTCT
CTTTTTTTTACTCTGTGTACATGTGCTTCCCAAGTGAATATTATTCACAT
TCTTCCCTCCAGCGGGGACAAAAAAGCATCTGAGACTGCGCGAGTAAAAA
TTCACAAGTGTCAAAACTAACATACAACAATTGCTATTCTATCCTAGATC
GATCAGTCAGCCAGTCAGTCAACATGGGTGTTCTCGATGTCCTTTCTAGA
AAGTCTGGCGTCATTGTTGGCGATGACGTTTTGAACGTGAGTCCCGAACC
CCGCGCCCTGTCGCATCAATATTTTTCCGCTTCCGAAGAATAGTGGATTA
AACTTAACAATTGGGCATTTCAAACTTCTGACGTTTCGTCTTCAAACAAA
CAGCTTTTTAAATACGCCAAGGAACACAAGTTTGCTATTCCTGCTATCGT
AAGTTCTGCGAATTCATTGCCCGCGATTTGACAAATCGTCCCAACTAATA
ACATTTCAGAATGTTACCTCTTCTTCAACTGTTGTTGCTTCTCTTGAAGC
AGCTAGGGACGCAAAGTCTCCTTTGATTTTGCAAATGTCCCAGGGAGGTG
CTGCCTATTTCGCTGGAAAGGGTGTCTCGAATACCGATCAGTTTGCGTCT
ATCTCTGGTGCAATTGCCGGTGCCAATTACATCCGCTCAATTGCCCCTGC
CTACGGCATTCCGGTCGTCCTTCACACCG

Sequences in the Contig:

SY0AAC31YM23FM1 SY0AAC37YC23FM1