Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4401
Length(NT) : 2655
Best Gene Model Blast : Link to GSTUMT00002518001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein SS1G_06528
Accession: ref|XP_001592288.1| Score: 1399 E_value: 1e-152
KEGG Definition: hypothetical protein [EC:2.7.11.1]; K08827 pre-mRNA-processing factor 4
Accession: ani:AN4936.2 Score: 1305 E_value: 1e-141
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0670 Score: 1325 E_value: 1e-146
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 421 E_value: 1e-41
Swissprot: Q07538|PRP4_SCHPO
Gene Ontology:
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0000398 = Biological process: nuclear mRNA splicing, via spliceosome
GO:0006468 = Biological process: protein amino acid phosphorylation

Sequence:
>Contig4401
TTGGGCTCCTCAGCGACCTCCCCCCCTGTGTCTTGCTAGCACAACCTTTA
AACTCCCACCCCTTTCTAGTTCATACGCTTTGCTCCCTGTCGTTCATATA
GAGAGCGTCTATATATGCTCTCTACCCGCCCACTTTCCCTCGATTACTTC
TACGCTCAATCGACCGGACAATCAGCTAAAGCTGTACTACGGAACTGAAT
CCCGAAATTCGTGTCTACAGAGATACTTAGAAGATAGACGTTTGTGCACC
ATGAATTCACCAAGCGAGTCATTTGACGAGGAGGGTGAAATTTTCGAAAC
AGAAGTAGAGAAGGCACCTCCATCGCTGCCTTCCGTTACTGGCCCCAGGG
TTGACCGTCTTTCAAGTAGAAACAGAGGCTCGAGATCTCCCGCCATCAAC
AATTACCGCGGCGGTAACGGTGACACCTACCCTCCATTTCGCCATGATCA
CTTTGACCCTAGAGACCACATCCGTCGACCTGGGAACGGGGAAAACATGC
GTGGTGAGAAAAGACGACGAAGCCACGAACGGGGCCCCGATCCCCGACAG
CACAGGGTCCACTACGAAGCAAATGGTGACGTCAATATCGGGAGGCGCCC
TAGGGTTTCGTATGCCGATATCGACCGCTCCGAGCCTAGAGATCCTCCCA
AACCTTTCGACCATGAGGACAGGTACTACCATGATACTAAGCGATCTCGT
ACGCGCAGTCGTTCGCCCCCACGGGGGCCTAGAGGAGATGGGAAAGGCGG
TAGGCGTGGATATTTTGACGATAGCAGACGTGATGGTGGTAACAGGTTCG
TTGACAGAGAGAGGGAACGGGACAGGGGTAGAAACGACAGCCGCAGACGC
TCCCAGGAGCAATCAGTGAGCGAACAAGGAGATATCCCAGTTCCGTCTGA
ATTATCAAAACGAGATACTGAATGCTACAACAAACAGTCAGATCAGGGGA
GTGGGAATAAACAGTCCTTTAGTTACCGTACCTCTCAGAATGGGGATAGC
GGAAGGTCCGCTCAAACCTCCAAGAGCATTGGGTTTTCTCCCAAAGCTGA
AATCTTGGGGGATGATAGAAACCCGCCCACCGAGAAGGCTCCGCTTAAAC
CACCGCCGGAAGAAATGGAGATTGAGGAGCCAGTTGATGAGGCTAAGCTT
ATTGAAGAGCGGCGTAAGAAGAGGGAGGCAATCAAGGCTAAGTATAAGGG
GCAAGCTACACCACTTCTTGTATCGGCGCTAGCGATCGCTGGATCAAACC
CGAACTCACCAGGAATGTCAGAGGGGGAGGCTACTCCAGCTGTAGCATCC
CCTGCGCCTCCTGATTCTTCGCGTGAAGACTCTCCGGCTGGTACCTTCAA
CATATCAAAGAATGGTGCAACTATAATCAATGCAGGTTCTACGGCGATGG
CAATTGCTGAGGATGAGGGGCCCTCGGCAGCAGATTACGACCCAACGGTT
GATATGCAGGAGGATAACAAACGGTACGAGCAGCGTATTCACGATCATGA
GGCGCCCTCTAGTGCATACGATGTGACCAAAGTCGTTGTGAGGGATGGGC
AGACACCGGCAAGTTTACCAAAGCAAGAACCGCAGCAGGAGCCTACAAAG
AAGGAGGATGATGATGATTTTGACATGTTTGCCGAAGGTGACGACGATGA
TATGTTTGCGGGGCCGATGCCAAAAGCAAAGAAGGTTGAAAGTCAGACTG
ACAAGACTCACCCCATTGTTTCTGACGCGAAGCAACTGGATGCTAGCCTC
TTAGATAACTGGGACGATCCCGATGGGTATTACCGCGTTATACCTGCTGA
GCTCCTTGATGGCCGCTACCGGGTACAGACAAATCTTGGCAGAGGAATGT
TCTCAGGTGTAGTACGAGCCCTGGATTTGACAACTCAGAAGCTGGTTGCT
ATCAAGATCATTAGAAATAATGAGACGATGAAAAAGGCTGGGTTGAAGGA
AATTGATATATTGAGGAAATTGATCGAAGCAGATCCAGATGATAAAAAAC
ATTTGGTTAGGTTAGAGAGATGCTTTGAGCACAAGGGCCATCTCTGTATC
GTTTTTGAAAACTTAAGCATTAATCTACGTGAAGTGCTCAAGAGATACGG
ACGAAGTGAGGGTATTAGTCTAATGGCAGTTCGTTCATATGCTCAGCAAT
TGTTTCTCGGTTTATCGCTCTTGCGGAAGTGCAATATATTGCATGCAGAC
CTGAAGCCGGACAATGTTTTGGCAAATGAAAACTGCAATATGCTCAAGAT
TTGCGATCTTGGTTCTGCATCCGATGCTTCTGAAAACGAGATTACTCCTT
ACCTCGTGAGTAGGTTCTACAGAGCACCCGAAATTATTCTAGGTATTCCC
TATGACTTTGCTATCGACATGTGGTCCATTGGGTGCACTCTCTACGAACT
ATACACTGGAAAGATTTTATTCACTGGCCGCACCAATAACCAGATGCTGC
GTTCGATCATGGAGTGCCGTGGAAAATTCCCACAAAAGGTGCTTCGTAAG
GGAAAATTCACAGGTTTGCACTTTGATGATATGCTTAATTTCAGGAGTGT
GGAGAATGATAAGATCACGGGAAAGGATATCACCAAGACGCTTGCCTTCA
ACAAGCCTATCAGGGAACTGAAAACAAGGCTCCTAGCTGCAGCATCGCCT
GGAAT

Sequences in the Contig:

SY0AAA10YO18FM1 SY0AAA27YM03FM1 SY0AAA39YA13FM1
SY0AAA63YJ19FM1 SY0AAB15YM16FM1 SY0AAC13YH05FM1
SY0AAC15YL17FM1 SY0AAC27YO04FM1 SY0AAC29YL03FM1
SY0AAC31YM16FM1 SY0AAC37YF17FM1 SY0AAC52YB20FM1
SY0AAC62YF11FM1 SY0AAD10YF07FM1 SY0AAD2YD01FM1
SY0AAD35YP12FM1