Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4400
Length(NT) : 1542
Best Gene Model Blast : Link to GSTUMT00009356001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: 6-phosphofructokinase (predicted)
Accession: ref|NP_595946.1| Score: 793 E_value: 2e-82
KEGG Definition: hypothetical protein [EC:2.7.1.11]; K00850 6-phosphofructokinase
Accession: spo:SPBC16H5.02 Score: 793 E_value: 1e-82
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2440 Score: 537 E_value: 2e-55
PFAM Definition: PFK, Phosphofructokinase..
Pfam Number: pfam00365 Score: 557 E_value: 1e-57
Swissprot: O42938|K6PF_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0003872 = Molecular function: 6-phosphofructokinase activity
GO:0006096 = Biological process: glycolysis
GO:0051726 = Biological process: regulation of cell cycle

Sequence:
>Contig4400
TTGGGGGTAAACTCATGATTGCTGGTAGAAGTTGGGGCATGAGGAGGAGA
CATGAGGGGAATTGTGGATGCTATCCTTCATGGCCTTGTATGATACGATA
TGTACGGTGGTGGGGACCATGATCAGCCCCACCAAACATCCCACTTTGAT
GGGCTTCCATGCTGAGCAAACCAGTCAACCACACATGGAATTAATTGCTT
TTCCCCTTTCTTTCCTTCACTCGTCGCTTTCTTTCCTCTTTATCCTCTCC
TGCCCCCCCGCCCCTCCGTTAGTTTGTTTGTCTCCTCTCTCTCGCACTTT
GTGCGACTAACGTGCTCTACCATCTTTCTTTATCATATTACCCCTTCACG
CATCATCATTCATCATCATTATCGTCATCACCATCATCATCACCGCTACT
GTTAAAGACTGCTCACTACTGTCTACTCCGTGTCCCGCGGATCCTATAAG
GCAATGACGGGCCCTACTCCTGATCAGAAGAATCTTCACTACTTCGTTAG
TGGTGTTTCTTCCATATCTTTAATTGCTCCTACAGAAGAGCTTTTTTATA
CCACTGTCGCTTTTTACACCGATCTTGGATTCGACGAGGCTTTCGTCTAC
GATCGGACTCATCCCACCGTTAAACGTGAGGATGATCATTGTCGCGCCTC
CGAGAAGGAGACCTGGTTGTACTCTCAAGGCGCGGCCGGCGACGGCACAG
ATGTCAATCTCAAGATCCGCTATGTAGTGGAAGCCGGACTTCGGAGGCAA
TCGTTAATCCCTCCCCCGATTCCGCCGAACAGCGAAGAATGGAGAGGAAA
GTCAATGAGTGTCATCTTGTACACCCCGGCCCTGGACAGAGTGATCGATC
TTCTTTCAGAGAAGAAGATTGCCTTCCAGTCCCAACCCAGCGAAAAGGAG
CCCTCGGAGGTGTACACCCATGACCCGTTGGGAACACTAGTTGGATTTAC
TTCTAAAGCAAATCCGTTTACTAGGGTCGGGCCCAGGTATGTTCCAGGCG
TCTTGGGGGAATCAAGGGTTCGGGACCAGACGAGACCCAGCACCCCAGGC
GGGGTGAAGAAGCGAATTGCTGTCATGACAAGTGGTGGAGACGCGCCAGG
AATGAACGCAGCGGTTAGAGCAGTGGTCAGGATGAGCATTGCACAAGGAT
GCGAGGCCTATGCGATCTATGAGGGATATGAGGGATTAGTACAGGGCGGG
GGGCTTATTAAGAGAATGCATTGGGAGGATGTTCGTGGTTGGCTCTCCGA
GGGCGGAACCTTGATTGGAACAGCCAGATGCAAGAAATTTACGGAACGCG
CAGGCAGATTACAGGGTGCAAAGAATTTGGTCTTGGCTGGAATTGATGCT
CTTGTTGTTTGTGGTGGTGATGGTTCTCTGACTGGAGCCGATATCTTCCG
TAGCGAATGGCCTGGATTATTGGCGGAATTAATCGAGCTGGGAGAGCTCG
CTGAGGAGCAGTGCTCACCTTTCAAAACCCTCAACATTGTTGGTTTAGTA
GGGAGTATTGATAATGACATGTCTTCTACAGATGCTACCATT

Sequences in the Contig:

SY0AAA37YL13FM1 SY0AAA52YA08FM1 SY0AAC24YJ17FM1
SY0AAC30YG06FM1 SY0AAC31YM12FM1 SY0AAC3YI13FM1
SY0AAC47YG21FM1 SY0AAC53YP17FM1 SY0AAC54YF07FM1
SY0AAC8YP14FM1 SY0AAD33YG03FM1 SY0AAD41YO04FM1
SY0AAD56YG06FM1