Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig440
Length(NT) : 653
Best Gene Model Blast : Link to GSTUMT00011228001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_09780
Accession: ref|XP_001551510.1| Score: 405 E_value: 6e-38
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06021 Score: 358 E_value: 8e-33
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2595 Score: 294 E_value: 1e-27
PFAM Definition: No Hit Found
Swissprot: Q2T9Q1|TBC20_BOVIN

Sequence:
>Contig440
TTGGATCGAGTTTTTCACAGGGCCTCTCTAACCTCCTAATCCAGGCCTAC
CCGACATCGATGAAAGACGAGAAACTATCCTCAACCTCGCCGTCGCCATC
ACCGTCACCGGCGGTGAAGCCTAAGAGCGATGATGGGGTTGGTCCGCTGA
GCCCCGAATCAGTCTCCGGATCTAGCTCACAAGATAGGTGGTCTACGGAA
AAAGTGAAAGCTATCAAGGAAGCTTGTCGAGCTGGTAATCGGAAAACTGT
TGTGGAGCTGGCAACATCCAAAGATGGCCTCATAAGCGATGGAATTCGTA
AGGAAGCATGGCCCTTCCTGTTAGGATATGGGACTGTCCCCCACGGGAAA
AGCGTGCCTCCCACAGATATACCTGAAGCATGCCCATCTTGGAAAACCCT
TCCTCCTCACAGAGACGAGGATCAAGTGAAGCTAGATGTGGACCGATCCT
TCATCTATTACCCCACTAATTTGTCACCTCGAGAGCTCAGGACTAGGAAA
ACCGAGCTTTTAGATTTAATTGTTAAAGTATTGCGGCGACATCCGATGCT
ATGTTATTTCCAGGGGTTTCACGACATCTGTCAGGTCCTATTATTGGTCC
TTGGTCCAACTGATGCTGTGGCCGCTGTTGAGCACATATCACTTTTGCGG
ATA

Sequences in the Contig:

SY0AAA24YB21FM1 SY0AAA24YB21FM2 SY0AAA55YP03FM1