Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig44
Length(NT) : 1179
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 3

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001213328.1| Score: 160 E_value: 4e-09
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_3G12380 Score: 151 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: DUF1713, Mitochondrial domain of unknown function (DUF1713). This domain is found at the C terminal end of mitochondrial proteins of unknown function..
Pfam Number: pfam08213 Score: 133 E_value: 1e-08

Sequence:
>Contig44
TTGGCCACATCATCGTCAAATCACTTCCACTTCGGACCTCCTCCTCTTCT
CACTCTGTGTCTGGACATCTTCGCACCCCCTTTTCTCCGCTTAGCAGTAG
ACAAGATGTTCTCTCTCCGCCATACTGCGCTAACCTCGCGCTTTGCCGGC
GTCCAAACTCTCCCCCGCTCAATGGTATCCATCGGACAGACCTCATCCCC
CACCATCCGTTTCCAACCAATGTTGAGATCTTATTCGTCATCATCTTCCT
CTAAGCCCTCTAAGCCCTCAAAGTCTTCAGATGGGACGTCTAGTAGCGGT
ATCGCTGGTACGCCTACCGTTCGAAGGTCAACTAGGGCGGGGACGAGAAA
CTCTGCCGCATCAACGGCGGCGAGAGAGCGATCAAAGGTCCCCGTGGTAC
CTAGCACTGACCATCTCCATCCAGCCGACGTAGCAGTGTCAGCCTTCTTT
GCCCAACACCGGCCAGTCAGTATCTCTCACCCGGTCCCACTGAACCACTC
GGAGAGCCTTTTCGGGAATATTTTCAACTCGCGAAAACCTGCCGTTGAAC
GCCCTATATACCAGAACTCTCCATCGCCAACAGACTTTGTGCACATAGAA
GTGGCGGTCGAGTCCGGATGGTTAGAATCCGCAATCCGATCAGCCTCAGG
TAGCGCTCAGCAGCAACAGCAGCAACAGCAGCAACAAGCAGCAGCAGTAC
AACCACAGCCGAATCAGCCTACACAAGGTGCCGCTGACTCGGCAAATCCG
GGCTACTCCTACCGGCCCTTCCATCCGCCTCCACCACCAAGGGCGCAAAC
TGCCTTCCTGAGGCCGAGACTTCAAAAGCAACTCATCCAACTCCTCCTCC
GGGCCGCGGCGCAAGGAGAAGGAACTTTTGCCGTCTCAGGCAACAGCAAG
CTCCTTCTCGAGCACATGATCCGCAAACGACGCACTGGTGAGGCTATGCC
TGATGAGAATCCCGGACGAGTGGTCATGCGCCTTCTTTCCGTCAAGAGGA
TTAGAAAACTCAAGATGAAGAAGCATAAGTTGAAGAAATTACGAAAGAGG
ACTAGATCACTGAGGAGGAGGGTTGAGTCTCAGAGGAAGTAGGCTTGGGC
TTTGGGGGTTGTGATGATATGGTGGATGGGGCAGTCGGGGCCAATCGGGA
AAGTTAGATGCTCTCTAATTATCCTTCCC

Sequences in the Contig:

SY0AAA11YJ20FM1 SY0AAB49YG05FM1 SY0AAC16YH10FM1