Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4398
Length(NT) : 1042
Best Gene Model Blast : Link to GSTUMT00008220001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: Mannosyl-oligosaccharide alpha-1,2-mannosidase precursor (Man(9)-alpha-mannosidase) pdb|1KKT|A Chain A, Structure Of P. Citrinum Alpha 1,2-Mannosidase Reveals The Basis For Differences In Specificity Of The Er And Golgi Class I Enzymes pdb|1KKT|B Chain B,
Accession: sp|P31723|MAN12_PENCI Score: 480 E_value: 1e-56
KEGG Definition: hypothetical protein
Accession: ncr:NCU07067.1 Score: 467 E_value: 2e-51
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG2429 Score: 182 E_value: 3e-14
PFAM Definition: Glyco_hydro_47, Glycosyl hydrolase family 47. Members of this family are alpha-mannosidases that catalyse the hydrolysis of the terminal 1,2-linked alpha-D-mannose residues in the oligo-mannose oligosaccharide Man(9)(GlcNAc)(2)..
Pfam Number: pfam01532 Score: 401 E_value: 1e-39
Swissprot: P31723|MAN12_PENCI

Sequence:
>Contig4398
AAAAATCCCCAGGGATTGAATTTATTGTGCCATGCATATTTCACGGACTT
TATTGACCGCGCTTCTCATAGCGGCGACAACATTGGGAGCTCCAAATATC
CCCCTTGAAGCAAGGAAACGACAGGCCACCAATGCGCGCACCGACGCTGT
CAAGGAGGCCTTCTTGCACTCTTGGAACGGGTATACCAAGTTTGCATTTG
GATTTGACGAGCTTTCGCCAGTTTCCAACAAGGGCACAAATTCTCGGTTT
GCCGCCAGTATTTCCCCGCGCACATGATATCCCGCAGCGCTGACGAGTGA
TGCAGTAATGGATGGGGAGCCTCTATCGTCGATGCGATGAGCACAGCGGT
CTTAATGGAGCTAGATGATGTTGTTCTGAAACAACTAGAGCATATCAAAA
CAGTAGATTTTACCAACACCGCCACTACCGTAAGTCTTTTCGAAACCACG
GTATGTACGCGCGCGTAAAAACTATAAGATCTTCTTAAGAGGAAACTGCT
CACCAAGATCAGATTCGATACCTCGGAGGTCTTCTCTCCGGTTATGACCT
TCTTATGGGCCCTTATAAAGACCTTTTGCCTAGCGTAAGATTTTCCCCAC
AAAGCTACACCCTCACAGGTTGTGATATTAACACGAGTGTAGAACTCGAC
CACGCTTATCAGCTCTCTTGTCGACCAGGCGGTTATCCTGGCAGACGCCC
TCGCCTTCGGCTTTGATACAGCCTCCGGCGTACCAGCCAATAACCTCAAC
TTCGCGAATAAGTCGTTCACCGACACCACCAACGGTATCGCGACTACCGG
TACCCTAGTTCTCGAGTGGACACGTCTAGCAGATATCACCGGCAATCGGA
AGTATGCAGAGCTTTCCCAGAAAGCCGAGTCCTACCTTCTGAGGCCGACC
CCATCCCTGGGCGAACCGTTCCCGGGATTGCTCGGAACAAATGTGGACAT
CAAAACCGGGCAATTCATCGACTCGCGCGGAGGATGGGGCGGTGGAACCG
ATTCTTTTTATGAGTATCTCATTAAAATGTGGGTCTACGATG

Sequences in the Contig:

SY0AAC31YM01FM1 SY0AAD27YK07FM1