Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4397
Length(NT) : 308
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4397
CTAGATTGATGGTTGATTTATTCATACGGCACTTTCTAGAAAAACACCCC
CTTTCTCCAATCCCCCGCCCCGCCTTTCCCCACTTTTGCCCAAACATCTC
AGCGCTTTGTTGCTACCCGTTGAAACAAATCGAGATCAGAAGAAGAAAAG
GAAAGAAAAGAAAAAACAATAAAAAGCACCAAACGAAATAAACAAAGATA
AAGGAAATCGTTAGGGAAATTGAAATTTATGTATCTCGTTAGAGGGAAAA
AAAAATGGGGAATCAAGGAAAATCGTGGAAATATCAACAACTGAAGATTG
GAAAGAGG

Sequences in the Contig:

SY0AAA19YB08RM1 SY0AAC31YL11RM1