Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4395
Length(NT) : 1672
Best Gene Model Blast : Link to GSTUMT00006004001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541108.1| Score: 403 E_value: 5e-37
KEGG Definition: hypothetical protein
Accession: ncr:NCU08594.1 Score: 325 E_value: 1e-35
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q12151|UPC2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0003702 = Molecular function: RNA polymerase II transcription factor activity
GO:0016126 = Biological process: sterol biosynthetic process

Sequence:
>Contig4395
ATATTATCCTCCAGCTTCTATCACTTAATTGCTTTATATTTGGGAACCGT
GTCATTGTTCAGGAGTCTTCGTCATTCAAAGTTAGGCGATCTTAGGACAT
CCACCATCTCCAGTTCGTATCATACTCGCACAAGGCACATCACGGCGTGA
CAGTGTCATCTTTCGGCGTGACATCCTAGCAAAGCCTTGCCTCAAAACGC
AACTACATTAATCCCTGCCATCCCACCTCGTATTCGTTCGGGCGCGCTTT
CGCGTTCGCACTTTCATATATTCCCATCTCCCCGCTTGTTTCTGCCCAGC
TCCTTTGCCTTCTCATTTTCTTTCGGCCTTTGGTAAGAGAGCGATTACGA
GGTCGTTTTGTTTTACCTGCTCCATTTCGGTTTTTTTTTTTTCGCGGTGA
TAATACTGTACTGTTGGCTGTTGGCAGGGAATGCCTCCGAGAAGAACACA
TACGAAGTCACGGGCGGGATGCGCCAAGTGCAAGAAACGGAGAATAAAGT
GATTCCTTTTTGGTCTTTATCTAGTGCGACGAGGTGCACCCTTCTTGCGG
GAATTGCGTCAAGCATGCCATTGAATGCGATTTTTCAAGCGTTGTCGGCG
TGCCACCTGCCGGCGTCGTTTCGGGTGCCCCTTCCTCCTCATCCGACTTG
CCGGCTTCGAATCCTATGACGTTGGATGCTAGTCCTCCGCCTGGGAATGG
GCAACACCAAGTCACCACACCGCATCAGCAAGGGATCTTCCCGCAGAGCA
CCGTTGCTACCGTTTCGCCCGTTATCAACATGACTGATATGGAGCTTATA
CACCACTGGTCGCTATCAGTTCCATCCTCATTTACTACAACGGAGGATGC
CGAGTCCATCTGGAGGGACGTTATCCCCCGCCTGGCCTTCCGAGAATCAC
AGGGTTGCTTGGTCCATGCTATGCTCGCCATTTCAGCATTGCACCTCGCG
TTCATCGAGCCCGACAAACGGTCTCAGAGGATGTGCGTTGCCGCAGACCA
CTACGGCGAAGCAGTGCGGGGAGTCAAGGACAGCGTTGGCGCCCCAGCGG
CAATCGGGAAGGATAATTGCGAAGGCCTCTTCGTCTCCTCGACATTGATC
GTAGTGTACGCAATTGCGAACCCAATGCTAACGGAGAAGGTCAGCCCGCC
GACGGAGATCCCGCCATGGACAATGCCGGCCTGGCTACCGCTCATCCGGG
GGGTGCACTCGATACTGAAGACGATGTGGGCGTGGATTGAGGCGGGATGT
CTATCCCCGCTGCTCCTCGGGCACACGTACATCGGCGATTCGGCCGGCGA
GGACGAGGCCATGAACGCGCTGTTCCGTATATGCACCGACAAGCGGGAAC
TGGACGCGGACGAGATCAAGGACTCGGCTGTCTCTCAGGCTTACTTTGGC
GCGATTCACGAGCTGCAGAAGAACTTTGCCAACGAGGTTGCTCTGCGCAG
GAAGATGGTGTCCCTGATATTCATATGGCCGATATCTGTTTCCGATGCCT
TCTTCGCTCTACTCCAAGAACGCAGGCCGCGAGCATTAATCATATTCGCG
CATTACTGCGTTTTGCTGAAGAAGTTGGAGAGTTTCTGGTGGGTTGAGGG
ACGGGCGAATTATGAGCTGGGAAGGATCGAGAGGACTCTGCCCGAACCGT
GGAGGAAGTGGTTGGTGTCCAA

Sequences in the Contig:

SY0AAA39YF03FM1 SY0AAB10YM24FM1 SY0AAC31YK15FM1
SY0AAC31YK15RM1 SY0AAC35YE11FM1